Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig39
Contig Information
Length 856 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9o16    rwhvd9o16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0321900 [Oryza sativa (japonica cultivar-group)] >gi|50252685|dbj|BAD28853.1| putative ribosomal protein L10a [Oryza sativa Japonica Group] >gi|113536221|dbj|BAF08604.1| Os02g0321900 [Oryza sativa (japonica cultivar-group)] >gi|215692826|dbj|BAG88217.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215734901|dbj|BAG95623.1| unnamed protein product [Oryza sativa Japonica Group]
Score 925
Evalue 6.19016e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig39
TGCCTCGTCGCGGAACAGTGCTCCCACCGCCGGCGCCATGAGTAAGTTGCAGAGTGACGCCCTGAGGGAGGCAATCACAAACATTATCAATGACTGCCGT
GAGAAGAACCGCAAGTTCGTTGAAACCATTGAGCTGCAGATTGGTCTGAAGAACTATGACCCGCAAAAGGACAAGCGTTTCAGTGGTTCTGTTAAGCTTC
CTCACATCCCTCGCCCAAAGATGAGGGTTTGCATGCTTGGTGATGCCCAGCATGTTGAAGAGGCAGGGAAAATGGGCCTAGACTGCATGGATGTGGAATC
TCTTAAGAAGATGAACAAAAACAAGAAGCTAGTCAAGAAGCTTGCAAAGAAGTATCATGCTTTCCTTGCATCTGAGGCTATCATTAAGCAGATTCCCCGT
CTTCTTGGACCTGGTCTTAACAAGGCAGGAAAGTTTCCAACTTTGGTGTCTCACCAGGAATCCCTTGAGTCCAAGGTTAATGAGACCAAGGCCACAGTCA
AGTTCCAGTTGAAAAAGGTGCTTTGCATGGGTGTTGCCGTTGGCCACCTGGGTATGGAGGAGAAGCAGATCTTCCAGAACGTGCAGATGAGCGTGAACTT
CCTCGTCTCTCTGTTGAAGAAGAATTGGCAAAACGTGAGATGCTTGTACCTGAAGAGCACGATGGGAAAGGTGTACCGGTTGTTCTAGACTCTAGTCTTC
TAGGATTTCCAGGAGATTGACAACTTGGGAACTTTTGTTGCTTTCTCAATTATCAAATTTTCGTGCGGGACGAGTGACAATTATTGTCTTGTACTGAGAT
GGTTTGTTCTATTGTCTGGAACTTGATGACATTTTATCCGTTGCCCCTGTGCCTTA
page-top