Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig37
Contig Information
Length 234 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9o13    rwhvd9o13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195626476|gb|ACG35068.1| hypothetical protein [Zea mays]
Score 113
Evalue 0.000237631
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig37
CCGGCCCGACCCGAGGAGCGTGCGCGAGGAGGTGGCGGAGGAGCTGCACCACCGCCACCCGTTCCACGGCTTCGGGCAGCAGCGGCAGCCGGAGGCGATG
CTGCTGCTCAGCCAGTGATTGGGAACTTGGAGAGGGATGAGCGCCGTCGCCTCCCCCCACTACTGTACTGTACTGTACTGTACTGTACTGTATGTCGGTG
TCAGCGTGTGATCTGGATCTGAAGAAAAAAAAAA
page-top