Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig35
Contig Information
Length 1292 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9d08    rwhvd9d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein SA [Zea mays]
Score 1128
Evalue 3.35462e-121
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig35
TCGCGACCTCTCCCGCCGCCACCACCCGTGCCTCCTCTTCCTCCTCGCTCTCTCGCGCACGGGGCTCGCGATCCGAAACCCTAACCTCCCACCATGGCGG
CTGAAGGCGGTGGCGTCCGGGCGCTGTCCCAGCGCGAGCAGGACATCCAGATGATGCTCGCCGCCGACGTCCACCTCGGCACCAAGAACTGCGACTTCCA
GATGGAGCGCTACGTCTACAAGCGCCGCACTGACGGCATTTACATCATCAACCTTGGCAAGACCTGGGAGAAGCTTCAGATGGCCGCAAGGGTCATTGTT
GCGATTGAAAACCCTCAGGACATCATTGTGCAATCTGCTAGGCCCTATGGACAGAGGGCTGTCCTCAAGTTTGCCCAGTACACTGGTGCTAACGCCATTG
CTGGCAGGCACACTCCTGGTACATTCACCAACCAGATGCAGACTTCATTCAGTGAGCCACGCCTTCTTATCCTGACCGACCCCAGGACTGATCACCAGCC
TATCAAGGAGTCTGCACTTGGAAACATCCCCACCATTGCCTTCTGTGACACTGACTCTCCTATGCGTTACGTTGATATTGGCATTCCTGCTAACAACAAG
GGGAAGCAGAGCATTGGTTGCCTATTTTGGCTGCTCGCCAGGATGGTTCTGCAGATGCGTGGTACCATTCTCCCAGGACACAAGTGGGAAATCATGGTTG
ATCTGTTCTTCTACAGGGACCCAGAGGAAGCTAAGGAGCTTGAGGAAGATGAGGCTTTGGGTGCTCCTGAGTACGCTGCAGTTGCAGAGTACACTGCCCC
AGCGGGAGATACCTGGGGGTGCTGAATGGCCAGGAGCTGCAGCTCCAGCTGCTGCCGTCGAAGCCCCGGCTGGGGCTGAGTGGACTGGTGCTCCAGCTCC
TGCGGCCGATGGATGGGATGCAGTTGCAGCACCTGCCCCTACTGGCTGGGAACAGGGCAGCGCTCCCGCACCCGCAGCAGCACCAGCTGCTACTCCGAAC
TGGGAGTGAAGGACTTGACCCAAGGTTTATGCTACTCGGCACTGTGGAGTGAAGGAGTTCGGCCGTGGTTTACGGGTGAAGGCTGTGTTATTTGCCCCGT
CAGTACTCTGTTGGTAGACGCTGGTTAAGTAGATTTAATTTTTACAGTGCTGAGTTATGTTAGATGGAAATCGATTTTTGTCTTCTTGGCTCTGCAGGGG
CTGGGAGTTATCACCCCAGCCTTCTGCTGCCTCTCATCGAATAGCTTTATTTGAAGTTCCATTTTGCCAGCAAGTGTATGGTCAGATTCTCT
page-top