Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig44
Contig Information
Length 971 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9e16    rwhvd9e16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit citrate synthase [Oryza sativa]
Score 1203
Evalue 4.40497e-130
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig44
CTGGACTATGCAGCGAATTTTTCACACATGCTTGGTTTTGATGACCCAAAAATGCTGGAGTTGATGCGCCTATACATAACAATTCACACTGATCATGAAG
GCGGGAATGTCAGTGCTCATACAGGACATCTGGTTGGAAGTGCTCTGTCAGATCCCTACCTTTCTTTTGCAGCGGCACTGAATGGTTTGGCTGGGCCACT
GCACGGCCTGGCTAATCAGGAAGTGTTGCTATGGATCAAATCTGTAATGGAAGAAACCGGGAGTAACATTACAACCGACCAACTTAAGGAATATGTATGG
AAGACACTGAAGAGTGGAAAGGTTGTTCCTGGCTATGGTCATGGAGTTCTTCGTAATACAGATCCACGATACTCGTGCCAAAGGGAGTTTGCGTTGAAAT
ATTTACCAGAGGACCCACTTTTCCAACTGGTCTCCAAGTTGTATGAAGTTGTGCCTCCAATCCTCACCGAGTTAGGCAAGGTGAAAAACCCATGGCCCAA
TGTCGATGCTCACAGTGGAGTGTTGCTCAACCACTTCGGATTAACTGAAGCACGGTATTACACTGTCTTGTTCGGTGTCTCAAGGAGCATAGGAATTGGA
TCTCAGCTCATCTGGGACCGTGCCCTTGGCCTACCGCTTGAAAGACCGAAGAGTGTCACCATGGAGTGGCTGGAAAACCACTGCAAGAAGGTTGCGGCTT
GAAGCTACACCAGTTCTTCGTCTTGCAACTTGAGTTGCCTTTGATGTTAATAATTCGACGACATAAATTAGGCACGTTTAGCCTCATTTTCCCATCTTTT
TCCTGTCCAATAACTGGAGCAAGAGGGGCTCCCAGACGGTAGAATTTTGTACCCAAGTCGGACAATCTGTCAAACTTGGCATGAAAGATTAGGACACAAT
GCTTGGGCTTTGTGTCGCTCGGCAACGTTTTTGTACTTTATGTTGCTCGAGTTTGAACCACACCAGTACGA
page-top