Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig33
Contig Information
Length 1253 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9d20    rwhvd9d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003504 [Oryza sativa (japonica cultivar-group)]
Score 1636
Evalue 3.98013e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig33
CGGGGGCACAACTAAAGTGGCTATCAAGCGTGGCAATCCCTTGTCTGAGCAGGGCATACATGAGTTCCAGACTGAAATTGAAATGTTGTCAAAGCTCCGG
CACCGTCATCTTGTGTCGCTGATTGGTTACTGCGAGGAGAAGAATGAGATGATCCTGGTCTATGACTACATGGCTCATGGAACTCTGCGTGAGCACCTAT
ACAAGACCCAGAATGCACCGCTTAGCTGGAGGCAGCGTTTGGAGATCTGCATCGGTGCAGCTCGTGGGCTTCACTACCTTCACACTGGTGCAAAGCACAC
CATTATCCACCGTGATGTGAAGACGACAAACATCCTCCTGGATGATAAATGGGTTGCCAAGGTTTCAGATTTTGGTCTGTCCAAGACTGGGCCATCGATG
GATCACACACATGTGAGCACAGTTGTCAAGGGCAGTTTTGGTTATCTAGATCCTGAATATTTCCGCAGGCAGCAGCTCACTGAGAAATCTGATGTGTATT
CGTTTGGTGTGGTGCTGTTCGAGGTCCTTTGTGCTCGGCCTGCCTTGAACCCCACTCTTGCAAAGGAAGAAGTTAGCTTGGCAGAGTGGGCACTGCACTG
CCAAAAGAAGGGAATTCTTGATCAGATTGTTGATCCCTACCTGAAGGGAAAGATTGTTCCGCAGTGCTTCAAGAAGTTTGCCGAGACGGCTGAGAAGTGT
GTTGCCGACAATGGCATCGAGCGCCCTTCGATGGGAGATGTGCTTTGGAACTTGGAGTTTGCTCTTCAGATGCAGGAAAGCGCGGAGGAGAGTGGAAGCA
TTGGGTGTGGGATGTCAGATGAGGGCACTCCCCTCGTGATGGTTGGAAAGAAGGATCCCAATGACCCATCAATTGATTCCAGCACCACTACGACCACAAC
AACTTCCCTAAGCATGGGTGACCAAAGTGTCGCGAGCATCGACTCGGATGGGCTGACGCCGAGCGCGGTGTTCTCACAGATCATGAACCCCAAGGGGCGG
TGAGGTAAAAATCTGGGTCTGCTTTTCAGTCAGTCACCGTTGGGGCCTGCCTAATTTATTCATTCAGCATATTTTCATGCGTTTGTGCTCTTGCTGTCTC
GCAAGTTATGCATTAGAAGTCAAAAAATTGTTCCATATTAGATATTTCTGTCTTGCCTTGTTTTTTTTTCTTCTTCCTCTTCTTCAGTGTTGTAATGACT
ATGCTTATTTGCATGTTGTTATTGTACCACCCACTGCTATGTGTTGTTGATCC
page-top