Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig32
Contig Information
Length 1132 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9k21    rwhvd9k21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0436700 [Oryza sativa (japonica cultivar-group)] >gi|51090649|dbj|BAD36430.1| serine protease-like protein [Oryza sativa Japonica Group] >gi|113631494|dbj|BAF25175.1| Os09g0436700 [Oryza sativa (japonica cultivar-group)] >gi|125605819|gb|EAZ44855.1| hypothetical protein OsJ_028338 [Oryza sativa (japonica cultivar-group)] >gi|215697857|dbj|BAG92050.1| unnamed protein product [Oryza sativa Japonica Group]
Score 969
Evalue 7.58011e-103
Total Hit Count 452
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig32
GGTCATGTATGCTTACCAAGCGGAGAAACACTTGAGGGCTCAGTATCAAATGTGGACTTTTGTTACAACATATGTGTGGTACATGTCCGGTCAACTTCGC
AGCTGCCAGCGAAAAGGTTCAGTGCGGACACTACATTTTTCAATTTCGATGACTGCCATTCGAAAGATGTTGTAGCTTTAGGCCGCCTTTGTAAGCGATG
GAGCTTGAACGTTGCTTCTGGAAAGCTAACCCCAAGAAGAAGCCAGTTTGATTGTGAAGAACTTCTTGTTTCATCTTGCAGAATTTCAAAGAGAGGTGTT
GGGGGTCCTCTGATGGATTTTGATGGAAATATCATCGGAATGAACTTCTATGACAAGAAAGAAACCCCTTTCGTTCCAGGTTTCATCGTGTTGAAGTGTT
TGCAACACTTCAATGATTTCGGGAGGGTCATACGACCGTTGCATGGACTGAGAGTTAAAACTCTTCACGAAGAACAGCTTACTGTACTTGAGAAGATACA
TCTGGTCTTCCCTGGGGTCTGTGGTGTCATAGTGGAGAAGGTACAAGTGCCTTCACCTGAACATTCTGAGATAAAGGCTGGGGACAGTGGTGTCATGGTG
GACAAGATAGAAGTACATTCACCTGAACATTCTGAGATAAAGGTTGGGGACATCATCACTCATGTTGATGGCATACCTTTCTCCAGTGCTGCAGAGTTTG
GTGGTATACTGCTTGATACGTGTGGTCAGCATATGCTAGAGAGGCAGAAATTGGGCCTACCGGAGAACGACAACCAGATGTCAACAGTGATAAGCCTAAA
GTTCGACGTGAAAACACAGAGAGGTCGCAAATCGGAAAAGACAACCAGAACAATCAACGTCGACAAATTTACTCCTAGTGGAAAGCTAAACAGGTGGCCA
CTTGGGAGAGCTTATCTTCTTCGCCGTATTGAGAATGGTATCCTGTACACCGAAGAGCGATATGGCTAACAGCGAAACTCTTTGTTTCATCCATTTGAGT
AGAATTAATACGTATCATGCTAGTGTAATTAGAAAGAGTTCGAGTTCATGTGGTTGATTGGAGACGACTTAATTTTAGCAAGCATTTTCTGCGGGGACAN
CTTCGGCCAAGTGAACCACTGCTAGAATGAAC
page-top