Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig27
Contig Information
Length 1029 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9m20    rwhvd9m20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0634900 [Oryza sativa (japonica cultivar-group)] >gi|49387541|dbj|BAD25097.1| alpha 2 subunit of 20S proteasome [Oryza sativa Japonica Group] >gi|113537047|dbj|BAF09430.1| Os02g0634900 [Oryza sativa (japonica cultivar-group)] >gi|215741147|dbj|BAG97642.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765416|dbj|BAG87113.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218191233|gb|EEC73660.1| hypothetical protein OsI_08192 [Oryza sativa Indica Group]
Score 1000
Evalue 7.06746e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig27
GCTGCTCTTCTCCGTTTTCCTCTTCTCTTCGCGTTCGACACTACTTCCGTCCCATCCCCCCTCCGTCTCTCTTCTCTAGCAGCCGCCTCGCCCTCTCGCT
CCGTCCGATCTCCTCCCGCAGCCCGAGAAAGCCGACGAGGTAGTCCCGCACGTCGGCCATGGGCGACAGCCAGTACTCCTTCTCCCTCACCACCTTCAGC
CCGTCGGGGAAGCTGGTGCAGATCGAGCACGCGCTCACGGCCGTCGGGATCGGGCCAAACCTCGCTTGGCATCAAAGCTGCCAATGGTGTAGTTATCGCC
ACTGAGAAGAAATTGCCTTCTATTTTAGTGGACGAAACATCTGTGCAGAAGATTCAGTCACTGACTCCAAATATTGGAGTTGTCTACAGTGGGATGGGTC
CAGATTTCCGCGTTCTTGTCAGAAAAAGTCGGAAGCAGGCACAGCAGTATTATCGGTTGTACAAGGAAACCATCCCCGTGACCCAGCTTGTCCGAGAGAC
TGCTGCTGTTATGCAGGAGTTCACACAATCTGGTGGTGTAAGACCATTTGGTGTATCACTGTTGATTGCTGGGTATGATGACAATGGTCCGCAGTTGTAT
CAGGTTGACCCATCAGGATCTTACTTCTCCTGGAAAGCATCAGCGATGGGGAAAAATGTGTCAAATGCAAAGACATTTCTTGAGAAAAGATACACCGAAG
ATATGGAGCTTGATGATGCCATTCATACTGCAATTTTGACTCTGAAAGAAGGATATGAAGGTCAAATCTCTGCCAACAACATTGAAATTGGAGTTATCCG
GGCTGACCGTGAATTTAAAGTTTTAACTCCATCAGAGATCAAGGATTTCTTGGAAGAGGTGGAGTAAGTTGCCCCTGGGCAATTTACTGTCTCCAACAAG
AAAAGTTTCCGGTCCATGAAGCTTGTCTCATGTTTTAAATTGGTCACTTAAACATATTGTAAACTGGTTCGCCCCAGTGACACCGGAAGAACTTACATTT
GAATCCTTGTGGATGGCATTGTGGACATG
page-top