Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig26
Contig Information
Length 220 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9e15    rwhvd9e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Physcomitrella patens subsp. patens] >gi|162677251|gb|EDQ63724.1| predicted protein [Physcomitrella patens subsp. patens]
Score 76
Evalue 4.53819
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig26
GTCTGAAGGAACAGATGACCCCTCTATCTGATTTCGAGGACAAGCTCTAAACTTTTAGTTCTGTTATCATATGGGTCTAGTTTGCTTTTGCTGCTAAGAG
AGCTGCACTATTATTTTCTGTCTGTTGAGTCGTGGCTGTATTGCTATTGGGATGTCCTATCACTTTGTTTTGATGTCTATCGATGTTAAAACTTAGATTA
TATATCTGTTAAAAAAAAAA
page-top