Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig25
Contig Information
Length 1375 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9k15    rwhvd9k15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0623500 [Oryza sativa (japonica cultivar-group)] >gi|48716234|dbj|BAD23770.1| putative lysyl-tRNA synthetase [Oryza sativa Japonica Group] >gi|113537003|dbj|BAF09386.1| Os02g0623500 [Oryza sativa (japonica cultivar-group)] >gi|215694818|dbj|BAG90009.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1667
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig25
AAGGTACATTGACATGATTGCAAATCCTGAGGTTGCTGATGTGTTTCGAACAAGAGCGAAGGTTGTTTCTGAAATCCGCAAAACAATGGAATCATTTGGG
TTCATTGAAGTTGAAACGCCAGTTCTACAGGGAGAAGCAGGTGGTGCTGAAGCAAGACCTTTTATAACTCACCATAACTCCCTCCAAAGGGATCTTTACT
TGAGGATTGCAACGGAGCTACATTTGAAAAGAATGCTGGTTGGAGGGCTCGAGAAAGTTTATGAGATTGGGAGAATATTCCGAAATGAAGGCATCTCTAC
TCGTCATAATCCTGAATTTACCACCATTGAAATGTATGAAGCATATTCAGACTATGAAAGCATGATGAATTTGGCTGAAGAAATTGTAACTCGATGTGCT
ATGGCTACGACTGGAAAGCTTAAGATTGATTACCAGGGAACTGAAATCTCTCTGGAAAGACCATGGAGAAGGGAAACCATGCATCGTCTTGTCGAAGAAG
CAACAGGAGTAGACTTCAATAGCTTTGGAGATGTTGAATCTGCTAAAAATGCTGCAAAAGGGCTGCTGGGGTTCAAAACAGAGAGCAGTGAGAATACTTC
ATTGCAAGCTTGTTCATCTGTTGGACATGTTCTCAACGAGGTCTTTGAGACTGTTGTTGAATCAACTCTTGTTCAACCAACGTTTGTTCTTGACTACCCA
GTTGAGATATCACCATTAGCGAAACCACATCGGAGGTATGCTGGTCTTACTGAACGATTTGAACTTTTTGTATGTGGCCGTGAAATTGGAAATGCATTTT
CTGAGCTCACAGACCCAATTGATCAGAGGAGTCGTTTTGAAAATCAAATAAAGCAGCACAATGCTAAACGTGCTGCGATGGATAAGGTCAAATTGGACGA
GAGTAAGGGGGATGATGAGTATTCCTATGAAGTTTCCTTGGATGAAGACTTCTTGACTTCTCTGGAATATGGAATGCCACCTGCTTCCGGAATGGGCCTT
GGTATCGACCGGTTAGTGATGCTTTTGACAAACTCTGCCAGCATAAGGGACGTTATCGCCTTTCCAGTTCTGAAGCTTCAGCAATAGGACCTTTGCTCAA
CGTAAGGAGAGATGCAATTTTGACAATGCCGAGCCGAGAAGAGATTCGGCGCATCCTGTGTCTTATGTTGAAGCAGTTTTGTTGTGTCTGACCAATATTT
CGACTGGTAGATCTTGTGTGCAATTATATACTGCTCATTACTTCATTGGTAAATGGATGGGGAGGAGGGTCGAGAGTGTTACGCGAAATAGTCACTAGGT
GCCGACGCTGGAATAAAAAATCGGTTCACATATTTATGGTTTCCTACAAGTACTCTTAGGTTGGAATGCTACGAA
page-top