Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig24
Contig Information
Length 768 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9h19    rwhvd9h19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Cu/Zn superoxide dismutase [Triticum aestivum]
Score 813
Evalue 4.92576e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig24
CAACCCCCAAAAGTTCTTCCGCTCCCGACGACCGCCATGGCCGCGCAGAGCCTCCTCTTTGCCGCCGCCGCGCCTCTCTTCCAGGTTCCTGCCTCTGCCC
GCCCTTTCCAGTCGCTCCGAATTGTCTCCACTCCAGGAGGCGCCACCGCCGCCGCCAGGGCGCTCGTCGTCGCCGACGCCACCAAGAAGGCAGTCGCGGT
GCTCAAGGGCACCTCCCAGGTCGAGGGCGTCGTCACGCTCACCCAGGAAGACGACGGTCCCACGACGGTGAACGTTCGTATCACTGGACTTGCTCCTGGA
CTTCATGGCTTCCACCTCCATGAGTTCGGTGACATGACTAATGGGTGCATATCAACAGGTCCACATTTTAACCCAAACGGCCTGACACATGGTGCACCAG
AAGATGAAGTCCGTCATGCGGGTGACCTGGGAAACATTGTTGCCAATGCTGAAGGTGTGGCGGAGACAACCATTGTCGATAGCCAGATTCCTTTGACTGG
CCCTAATGCAGTTGTTGGGAGAGCGTTTGTTGTTCATGAGCTTGAAGATGACTTGGGAAAAGGTGGGCATGAGCTCAGCCTCAGTACTGGAAATGCTGGT
GGAAGACTTGCATGTGGTGTTGTTGGCCTGACCCCGTTGTAGGTCGCTGGTTTCCATCTCTGGTTTTGCATCTCTAGTCATACTTGTAACGACGCCATTC
TCGTTTTACCTGGATTTCAAATATCGGATGCTTAATAGTTTCTGTTGATCGTTTGTATCAGTGAAAGT
page-top