Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig22
Contig Information
Length 871 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9l15    rwhvd9l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dehydroascorbate reductase [Triticum aestivum]
Score 1108
Evalue 3.80942e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig22
CGCCCTCTCCGCTTTCCTGCTGCTGGTGCTGTTAACCGGACTCCCCGACGCCGCCGTCGCCGCCAACATGACCGAGGTCTGCGTCAAGGCCGCCGTCGGC
CACCCCGACACGCTCGGCGACTGTCCCTTCTCCCAGAGGGTGCTGCTCACGTTGGAGGAGAAGAAGGTGCCCTACCAGATGAAGCTCATCGACGTCAGCA
ACAAGCCCGACTGGTTCCTGAAGATCAATCCAGAGGGCAAGGTGCCTGTGTATAACGGTGGTGATGGCAAATGGATTGCTGATTCTGATGTGATCACTCA
AGTCATTGAGGAGAAGTACCCAACTCCATCACTTGTGACCCCTGCTGAATATGCATCAGTGGGATCAAAGATCTTCTCCACCTTTGTCACGTTCTTGAAG
AGCAAGGATGCCAGCGATGGTTCGGAGAAGGCACTTGTTGATGAGCTGCAGGCGCTCGAAGAGCACCTGAAGGCCCATGGACCCTACATCAATGGGGCGA
ACATCTCCGCTGTCGATCTCAGCCTGGCTCCGAAGCTCTACCATCTCCAGGTCGCCCTGGAGCACTTCAAGGGCTGGAAGGTCCCTGAAACCCTGACCAG
CGTCCATGCCTACACCGAGGCTCTCTTCAGCCGCGAGTCGTTCGTCAAGACCAAGGCGACCAAGGAGAACCTGATCGCCGGGTGGGCGCCGAAAGTGAAC
CCGTAAGCCCTCCCGCCGCTCGGAGACCCGGCCCACCCCCGTCGTGTGAGAGTAGCGACGGGCCTCATCTGTCTAGGTTGGAATAATGCGAGCGAGCCTT
GATGTGCTCTGGTTGTCGCAAGACGTGCACTTGCTGCCTGGGCTGTGCCCTGCCTGGCTTGTGTGTGTGGG
page-top