Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig20
Contig Information
Length 923 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9f06    rwhvd9f06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 635
Evalue 1.60731e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig20
CACCCAATCTCGTCTCCGATCGACTCGAGAGCTCGTCGAATCCTCCTCCCCCATCGTCTCAAGATGCAGATCTTCGTGAAGACCCTCACTGGCAAGACCA
TCACTCTGGAGGTTGAGAGCTCTGACACCATTGACAATGTTAAGGCTAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTGATCTTTGC
TGGCAAGCAGCTGGAGGACGGCCGCACCCTGGCCGACTACAACATCCAGAAAGAGTCCACCCTTCACCTGGTGCTCCGCCTCCGTGGTGGTATGCAGATT
TTTGTGAAGACCCTCACCGGCAAGACCATCACTCTGGAGGTTGAGAGCTCTGACACCATTGACAATGTTAAGGCTAAGATCCAGGACAAGGAGGGCATTC
CCCCGGACCAGCAGCGCCTGATCTTTGCTGGCAAGGCAGTTGGAGGACGGCCGCACCCTGGCAGACTACAACATTCAGAAGGAGTCCACCCTTCACCTGG
TGCTCCGCCTCCGTGGTGGTATGCAGATTTTCGTGAAGACCCTCACCGGCAAGACCATCACTCTGGAGGTTGAGAGCTCCGACACCATTGACAATGTTAA
GGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTGATCTTTGCTGGCAAGCAGCTGGAGGACGGCCGCACCCTGGCCGACTACAAC
ATTCAGAAGGAGTCCACCCTTCACCTGGTGCTCCGTCTCCGTGGTGGTCAGTAATTGCTCTGGCGTTTGACCTGCTGGTTTATCCTGGTCGTCCGGTGGG
TGGTGCCCTGTCGTTCATTTGAACTGTTTCTCGTTCGTGTCAGTCCTAACTGTGTTGGTTTAATGAACTATCGAGTCCCCGTGTTATTTGTTGGTGAAAC
GGTTGCTGGCACAGCAGTATCGT
page-top