Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig18
Contig Information
Length 468 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9g11    rwhvd9g11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09704 [Oryza sativa Indica Group]
Score 86
Evalue 0.0127087
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig18
GCTCCTTAGCTCGAATAACAACCCTAGGAGTAGGACAGATGGATTTAGCGGTGGCGGAACATCACGGACGCCCCCGAGGGGGCAACGGTAGAGAGAGGGG
GGTATGTAAATTCCACGAGAGCGGGTACCGCAGCTACCTGCACACGTCACGTCGTTTTCTACAAGAGTAGAGAAATGCAAGTTTTTGAGATTCTTTGGGT
CATATGTTTCCACTTTTGTATAGACTAATCAATGAATGAATGAATGAATGAATCACGATGGTAGTCGAGCGTAGGAGGGGATCTCCATTCAAGTGTAGTA
GTAAGAGTAAGAGTACTGAGTATATATATGTATGTCTAGCATAGGAAGATGACAGAGTGTTTCCCCAAGTAGATTTGTTTTGTCTGTTGGGGGTGCATGG
CAATATTCCACCTGGAACTGCATGTGTACCAAAAACTATTTTCTTTCTTTCTTTCGTTAAAAAAAAAA
page-top