Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig17
Contig Information
Length 775 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9f15    rwhvd9f15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hCG1997303, isoform CRA_d [Homo sapiens]
Score 93
Evalue 0.154239
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig17
TCTCATCTCCTCTGTATCCTGACCACACAGTAATCCCCAAATCACGCCGGCGACAGCTCCGATTCCAAAGCACAGCGCCGCCCCTTCCTCCGGTGCTCCC
ATGGCGCGGCTTCTTCCTCAAGCCGCCCGGCGCTGCTTCGCCGGTGGCGCAGCCGCGGGAGTCCTTCGTGCGGGGGTCCAGGCCTTTCTCGATGATGCAG
CCGGTGTCGGGGAGGAGTCGCGCGGGGTCACGCCGGGGGTAAAGGACCTGGCCCAGGTGGTTCTCGACGAGCCGTGTGCATAGGGGAGCAGGATCCGTCT
TCTAGCAGAGGAAAAACGAGAAGGGTGTGGAGAGCGAGGTCGCTGCCGGAGCTCTGCCGGAGCGAGGTTGATTTGGTGTTGCGTTTTCAGGTCCGGGTAT
TGGGTTGCTGGAGGAAGGGAGGAGGCGTTGGCACAGTGCTGCAGCTTGGTCAATATTGATTCACTTCTCAGGGCAGCCACCACATGCAATGGTCTATGCC
ACTCCTGAGCGTATGGGATGCATCAATCGGTCAACAGCTCTGTGACCGCAGTGGGAAGCTATGTACAGGGATCTAGATGAATAGTCAAGTGATGTCCCTG
TTGATGACAGAGCTGGTCAGCTGCTCACGTGAAGAATCTCTGCTGCTCACATGGAGGCACTTTTTTTCTTTCTTTTGCCGATGGAGGCACCGGGTGAAGC
ACCCGTGACTTTTCGGGAGCGGTTATTTCTTCGAAGCACCGGCTGGCACCGGAAGCAAATGTTGCTNTCCCCCCC
page-top