Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig16
Contig Information
Length 1104 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9f24    rwhvd9f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lycopene beta-cyclase [Zea mays]
Score 1502
Evalue 1.15388e-164
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig16
GTCGCCAAGGTGGTCCACAACGAGGCCTCCTCCCTCCTCATCTGCGACGACGGCGTCGCCGTCCCGGCCACCGTCGTCCTCGACGCCACCGGCTTCTCCC
GCTGCCTCGTGCAGTACGACAAGCCCTACAACCCGGGATACCAGGTCGCCTACGGCATCCTCGCCGAGGTCGACGAGCACCCCTTCGACATCGACAAGAT
GCTCTTCATGGACTGGCGCGACTCCCACCTCCCCGAGGGCTCCGCGATCAAGGAGCGGAACAGCCGCGTGCCCACCTTCCTCTACGCCATGCCCTTCTCG
CCCACCAGGATCTTCCTCGAGGAGACGTCGCTGGTCGCGCGCCCGGGGCTCTCCATGGACGACATCCAGGAGCGCATGGCCGCGCGGCTGAGGCACCTGG
GAATCCGCATCCGGAGCGTCGAGGAGGACGAGCGCTGCGTGATCCCCATGGGCGGGCCGCTGCCCGTGCTGCCGCAGAGGGTGGTGGGCATCGGCGGCAC
GGCCGGGATGGTGCATCCGTCCACAGGGTACATGGTGGCGCGCACATTGGCGACCGCGCCCATCGTGGCAGACTCCATCGTGCGGTTTCTAGACACCGGC
AACGGCGGCATCGCCGGGGACGCGCTCGCCGCCGAGGTGTGGAAGGAGCTGTGGCCGACGGACAGGCGGCGGCAGAGGGAATTCTTCTGCTTCGGCATGG
ACGTCCTGCTCAAGCTGGACCTCCAAGGTACACGACGGTTCTTCAACGCATTCTTCGACCTCGAGCCGCACTACTGGCACGGCTTCCTCTCGTCGAGGCT
GTTCCTGCCTGAGCTCTTGATGTTTGGGCTCTCGCTGTTCGCGCACGCTTCCAACACGTCCAAGCTGGAGATCATGGCCAAGGGCACCGTGCCTCTTGCC
AAGATGGTCGGCAACTTGATACAGGACAAGGATAGGTGATGACTTAGAGGGTATGTATGTACCTGCATTTCTCATCTCAAGATCTTCATGGGGTCTTTGA
TTTTGGCATAGCTTTTCTCAAATGTATCTATGATTGGCAAAGAGGATTTAAATAGCACTGCTAGCAACAGCAGCTTAGGACCTCCAGAGAGATGTAACAA
TTCT
page-top