Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig15
Contig Information
Length 1288 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9g08    rwhvd9g08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Chlamydomonas reinhardtii] >gi|158270268|gb|EDO96148.1| predicted protein [Chlamydomonas reinhardtii]
Score 81
Evalue 8.52592
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig15
ATCGCGCCCCCGTCCACTCCTCGCCGTGGGCGCCCCGATCGGGAGCCACCGCGCTCGTCCCCGTCGTTGTCCGCCGTCACCTCGACCTCTGCTTCCTCCT
CGACCACGACCTCGAGTAGAAGACCGCCTCAATGTAGAGATCGACGCCGCTCCTCCACGTCGGCCATCACCTCCGTCCGCTACGGTCGCCGTCGTTTTCC
ATGGCTCCGGCACCGCCCTGCAGCTACTAAGCCGTCGAAGGGCCACCTTGTGCCCCGCGGGACAGTTATGGGCACTCAACGTCGTGGTATCAGCCGAAGC
CTTCGTGACGTCAGCGACTGAGTGGCGCGCGCGGGATTGGACTGGAACGCCTGCTAGGCTAGGTCTGCTTCCGGCCGCGTTCGCAACAGTGCAGGTGTGC
AAAGGGCGATGGGCCCAGACCCCTGTGTCATAGGATTTAGACTGGCGTGCTGACCTCTCTGTTGTGCCTAGGTAGGGCTACGACGTGTTGATCTTCCGAG
GTCGGGCATGACCCAAAAAAGTGTGTCCGGCCAAATGGGATCGAGCGTGTTGGGTTATGTGGTGCACCCCTGCAGGGAAGTTGATCTATTCGAATAGTTG
TGTCCCTCGGTAAAAGGATGACCCGGAGTTGTATCTTGACCTTATGACAACTANAACCGGATACTTAATAAAACACACTCTTCCAAGTGCCAGATACAAC
CGGTGATCGCTCTCTCATAGGGCGACGAGGGGAGGATCATCGGTTAGGATTATGCTATGCGATGCTACTTGGTGAACTTACCATCTACTCTCTTCTCCTG
CTGCAAGATGGAGGTTACCAGAAGCGTAGTCTTCGAAAGGACTAGCTATCCCCCTCTTATTCCAGCATTCTGCAGTTCAGTCCACATATGATACCCTTAT
TCCATTTGATACCAATGCATACACATGTAGTGTAGCTCCTTGCTTGCGAGTACTTTGGATGAGTACTCACGGTTGCTTTGCTCCCTCTTTCCCCCTTTCT
TTACTCGATTGCTGCGACCAGACGATGGAGCCCAGGAGCCAGACGCCACTGTCGATGACGACTACTACTACTCGGGAGGTGCCTACTACTACATGCAGCC
CGCTGACGGCGACCAGGAGTAGTTTAGGAGGATCCCAGGTAGGAGGCCTGCGCCTCTTTCGATCTGTATCCCTGTTTGTGCTAGCCTTCTTAAGGCAAAC
TTGTTTAACTTATGTCTGTACTCAGATATTGTTGCTTCCGCTGACTTGTCTATGATCGAGCTCTTGTATTCGAGCCCTCGAGGCCCCG
page-top