Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig13
Contig Information
Length 994 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9i15    rwhvd9i15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit haloacid dehalogenase-like hydrolase family protein, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 855
Evalue 1.02973e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig13
CTTGCATCACCAGCGCCCGATTCAGCAGATACAAGAACCACACCGCGCGCGCCTACCGGAGGGGCACCGGAGCGTCGGATATGTCGGCCGCCGGCGACAG
GGATCTGCGGGAGCTGGCGCCGCTGGAGGCGATCCTGTTCGACATCGACGGCACCCTCTGCGACTCGGATCCCTTCCACTTCCTCGCCTTCCGCGAGCTG
CTGCAGGAGGTTGGTTTCAACAATGGAGTCCCCATCACCGAGGAGTTCTACAGCGCCAACATCAGCGGGTGGCACAACGACGCCCTCGCCGGTGCTCTGT
TCCCGGAGCTCGAGCACGCCAAGGGCATGGAGTTCATGGATCGCAAGGAAGCCCTGTTCAGAAAGTTGGCGGCAGGAGAGCTCAAGGGACTGGAGGGACT
GCAGGAACTGTGCACATGGATCGAAGGACGCAACCTGAAGCGGGCGGCGGTGACGAACGCGCCGAGGGCGAACGCGGAGCTCGTGCTGTCGCTCCTCGGC
CTCACCAGCTTCTTCCCGGTGCTCGTCATCGGGAGCGAGTGCGAGCGGGCCAAGCCGTCCCCTGACCCGTACCTCAAGGCCCTCGAGCTCATCGGCGCGT
CCCCCGATCGCACGTTCATCTTCGAGGACTCCGCGTCCGGGATCCGGGCCGGCGTCGCCGCCGGCGTGGCCGTGGTGGGCCTGACCACCGGGAACCCGGA
GAAGGTGCTGAGGGACGCGGGGGCGAGCCTACTGATCGAGGATTTCCGGGACCCGAAGCTGATGGCCATGCTTCAGGAGCTGGACCCTGCAGCTGCAGAT
AAGGAAGGCTGATGTTCGCGGACATGCTTGCTAACTGGACACGGGCGACTAGTCGGTGATCCCCATTTTTCTAAGTTCAATATTTCATCGCACACGAGCA
TGAATAATTCTGCAACTACTATTTAACTTCCGCCGATGCGCGAATGTGCGTGATCAGAAGAGTTGAGCGCACACTCCTTAGGATGTTCTCTCTT
page-top