Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig11
Contig Information
Length 949 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9i08    rwhvd9i08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012816 [Oryza sativa (japonica cultivar-group)]
Score 1109
Evalue 3.36811e-119
Total Hit Count 378
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig11
CCGCCGGCGATTCCGTAGACGAGCGGCGAGAGGCGAGTAGCAGAGCGAGCGGGGAAGCTAGGGTTTCGGCGTGTGTGTGCGGGAGGGGAGAAGAGGAGCG
GGGATGGCGCAGGCGGTGGAGGAGTGGTACCGGCAGATGCCCATCATCACGCGCTCCTACCTCACCGCCGCCGTCCTCACCACCGTCGGCTGCACCCTCG
AGATCATCTCGCCCTACCACCTCTACCTCAACCCCAAGCTGGTGGTGCAGCACTACGAGATCTGGCGCCTCGTCACCAACTTCCTCTACTTCCGCAAGAT
GGATTTGGATTTTCTGTTCCACATGTTTTTTCTTGCGCGCTACTGCAAACTTCTCGAGGAGAACTCATTCAGGGGAAGAACGGCTGACTTTTTCTACATG
CTCTTGTTTGGTGCTACTGTCCTGACTAGCATCGTTCTGATTGGTGGGACAATACCTTACATCTCTGAGACGTTTGCTAGGATTCTGTTCCTCAGCAATT
CATTGACGTTTATGATGGTTTATGTCTGGAGCAAGCACAATCCCTTCATTCACATGAGCTTCTTGGGTCTGTTCACCTTCACTGCTGCCTACTTACCTTG
GGTCCTTCTTGGCTTCTCTATTCTGGTGGGGAGCAGCACATGGGTTGATCTTTTGGGTATGATTGCTGGTCATGTGTACTACTTCCTGGAAGATGTGTAC
CCTCGGATGACCGGCCGTCGCCCCCTGAAGACCCCTTCCTTCATCAAGGCGCTGTTCGCCGATGACAATGTGGTCGTGGCGGCGCGGCCACCCAACGCTG
GTGTTGGCGCGGCCGCAAGGTTCGGTGGCGTGGGTGCAGCAGACCCCCAGTTCCAGTGATGATGGACATGCAGTTTGTTGGATATAATTTTGTACACCCG
TGTCCGTGATGATATGTGCAAAAATACATACAGAGTATAATTCTCAGTA
page-top