Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig7
Contig Information
Length 413 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd5f20   
Homology (BLAST) Top Hit stress responsive protein [Triticum aestivum]
Score 188
Evalue 4.71443e-13
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig7
TATGTGATAGGCCACCCCTAGAGGGTTGTGCCGGTTCCCCCCAAAGCCTATTGTCTTACACTGTGCATGCGTATTTCATTGTTTTTACGTATCACGAAGG
TCCTTTATTGTTACGTAACTTGTCATTACACACACAAGCACAACAGCTCCGTTATTCTGCGGGGTAGGTAGCGAGAGACGCATGCATGTTGTCTATCCGG
GACGGTCCACATGACATCGTTTCTTCAGTAGATACGTACGTACGCATGTGTGGATATCTCGATCTCCCCGCGTACGTGCACGAGCCATGCATGGCGCGCG
CTGGCTGGCTGGCTCAGTAGTACGGCTGGAGCTTCCAGCGCTGGTTGTCGCCCTCGCACCACTTCCAGAGCACGACCTCNGTGCCGTCGCGCACGCCGCC
GTGGNACTTGTCG
page-top