Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig6
Contig Information
Length 735 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd6p23   
Homology (BLAST) Top Hit hypothetical protein OsI_17116 [Oryza sativa Indica Group]
Score 486
Evalue 3.76543e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig6
CAGTTATTACATCCGCCACAGGGAGCTATAGTACAACTGTACAAGAGTATCATCGAATCCGACATGAATGCAGAATTATTCAGCTATACAGCTTATCCGA
GAATTCTGGAATCAGATCATTTTGGTGGTACAATGGTGCCATTTTCTACAATACATTTACAGTGTCAATTTCTCCATGATTCAGGGAAGCTTGTACGTAG
TTTCAAGGAGCATGGAGGCAAGCAAATATTTACCTATTTTGCTTCAAATTTACAGACACCCGATCGTCATGCTCCGATGCTGAAGATGAACATCAGGAAC
TCGTGGAGTGTGAAATCAGGTTTTCTCCTCCACGGAATTGAAGTAATCCTGGAGCCACCTGACATGCACCTCCAGCCCGGCTTCCCGGAGGCTGTTGAGG
ACGATCATGTACAGCCTCCTGTCCAGCTTGGTGCCCTGCAGCTTCATGTCCCTCAGCAGCTGGATGAGGTCGTTGAAGCGGCTGGTCTTGCAGAACACCC
CCACCATGAGCCCGGCCAGGGTCTTGTCCACCGTCCCCCCCGTCTCCCTGAACTCCTGGTAGTANTCCATGCACCGGTCCAGCTCCCCCGACCGGTTGAA
CGCGCCGACGATGGCCGTGTANCTCACCCGGNCGGGCTGCACCTTGCGCCNCATCNTCTCCTTCCANATCTTCTCGGCCTGCCTCNANTCCCCNANCTTG
CCNCNCATGTCCNNGANCNANNNNNANNNNNGGGG
page-top