Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig5
Contig Information
Length 263 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd20d16   
Homology (BLAST) Top Hit hypothetical protein OsJ_012034 [Oryza sativa (japonica cultivar-group)]
Score 87
Evalue 0.246661
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig5
GACTCGGGGATCNCTCGCGTCGGTAGTGCTGCTGATTGGTCTAACCACTTCTAGCTTGATGACCCTTGTTGTAAACTGCCAATCTTGACACTGAATCGCT
GAGACACCGCATTTTATTTTTGAGCAGTTTACAACGCTCTAGACAATGCTGTTTCAATAAATGTACTGTCTGATGGGTAATGATACTGCTGTAAGTTTAC
CGATACTCGAAGAAACTCTGATGCCACCACCTGGTGGTAGAGATTTATCAGTCCCCCCTAANA
page-top