Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig4
Contig Information
Length 823 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd11k04   
Homology (BLAST) Top Hit Os03g0717900 [Oryza sativa (japonica cultivar-group)] >gi|108710769|gb|ABF98564.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113549555|dbj|BAF12998.1| Os03g0717900 [Oryza sativa (japonica cultivar-group)] >gi|215704521|dbj|BAG94154.1| unnamed protein product [Oryza sativa Japonica Group]
Score 818
Evalue 1.46702e-85
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig4
TCGCTCCCCTTCGAGCGGAGCCGCAGCTTCGCCCTCGGCTCCATCAAGGGCCTCGGGCGGCGGCAGCTCACTTCCAGGAGGCTACGCAGCGTGGTCAGGG
CATCCTCCTCGTCCCCGTCGGAGTCTCTGCCATCTTCTTCGCCGATCGCCCCGCTGCAAATGGAGTCGCCGGTAGGGCAGTTCCTCTCGCAGATTTTGGT
CACGCACCCGCACCTGCTCCCGGCCGCCGCCGAGCAGCAGCTCGAGCAGCTCCAGACCGTCCAAGACTCTGCAGAAAAGAAGGACGCGCAGGCACCGCCG
GCAGCCGGCGATATCGTGCTGTACAGGCGAATTGCCGAGGTTAAGGAGAAGGAAAGGAAAAGGACCATGGAGGAGATACTGTACGCGCTGGTTGTTCAGA
AGTTTGTTGAAGCTGGCGTCTCTTTGGTCCCAGCTCTCTCTCACTCCATCGATACCTCTTCTGGTAGAGTAGATCAGTGGGCAGAGCATGTGGAAGGGAA
GCTTGAGCGTTTGCACTCACATGAAGCATATGAAATGATCGAGAACCACTTGAATCTCATATTGGGGCAGCGGCAAGCCGATGGCACTGTCGCGGCCATA
AGTAAGCTCCGAGTTGGCCAGGTCTATGCCGCATCAGTAATGTATGGCTACTTCCTCAAGAGAGTTGACAAGAGGTTTCAGCTGGAGAAGTCGATGAAGA
GCCTCCCTTGGGGATCANAAGACGATGCGCTCAATCAAGTTATGACGACTGACTCACGGCCCTCGGATCANACTTACAGTTCCCATCCAGAAGGTGGAGT
CGTGGACTTCCCCANACCTCANC
page-top