Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig3
Contig Information
Length 543 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd19b14   
Homology (BLAST) Top Hit hypothetical protein OsI_17784 [Oryza sativa Indica Group] >gi|125591947|gb|EAZ32297.1| hypothetical protein OsJ_015780 [Oryza sativa (japonica cultivar-group)]
Score 731
Evalue 7.24377e-76
Total Hit Count 314
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig3
TCGCTATCCCCATCTTGAGGCNAACAAGGACATTCAGCTCCCTGCTGCAGTAGGTACGGCGGCTGGCTTCAAATCCTCGGCCTTCTCATGTTCCTTGTTT
AGCATCTTGTTGTTGATCAAATTGTGGAGAGCAATGACACTCCGGATAAGAGAAGACAGGTATATGACCAGCATCATATCATTTGTTTTCACTGCAAAGG
CTTTAATGAGCTCATTTACGTTGAGATTGGGGAGCAGATTAAACACATCCTGCAAGTGGTACAGAATCTCATGGTTCAGTGGGAGCTTCCCTTCAATTAC
AAGATCTAGATAACCCCGGATCTCCGTAAGCCTCGCATCGAGTCCCTTCAGGGCTGCAAGCTTGCTGCTGACCTCTGTGGCAAGTGTGCTTATTGTTGTG
TCTTTCACATCCCTCAGAAGGTGCTCAACTCCAATTTCCTCNACTTCATGGGCCGCAATTTCTGATGGCACNTGGACNAACACCTTCTGACTTTTCNGAN
NANCNTTCTCTTTAACCTCCTTCTACNNCNTANTATGCTTTGG
page-top