Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig2
Contig Information
Length 731 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd3j19   
Homology (BLAST) Top Hit hypothetical protein OsI_28383 [Oryza sativa Indica Group]
Score 579
Evalue 6.08361e-58
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig2
CCTCCCGTTTCCACCTCTCTATCCTATGGATAGAGCCGCCGCGACAGCCATAGATATCCTCGCTATGATCCCATCAGCGCCCTCTCCTTTGTAGCACCAT
CTCCCCTCCCCCANCCCACCCCCGGGTTTATTTGACAAGATTTGATCCCAATCCTCGCACGTTTCTTGGCCGAGTGGGGGAGAAGATTCCAGAAATGGCC
GTCGCCGTAGCCGCCGGGACCCTCCGTACCTGTTCCGGCGTATTTCCGGCGGCGTCCGGGAACCATCCGCTTGCCGGGTGGCGGCCACTTGCACCGGCAG
CGCCCGCTAAGCTGAGAATGGGAGCTCTAGCAACAGTAATACAGTCCCTACACCGAAAGTTATAATAGATCAAGACTCAGATCCAGATGCAACTATTGTG
GAAGTAACCTTGGGTGACCGTCTTGGGGATCTCCTTGATACTATGAGTGCCTTGAGGAATTTAGGGCTAAATGTTGTGAAAGCTAGTGTTTGCCTCGATT
CTTCTGGCAAACACAATAAGTTCGCTATAACAAAGTCGTCAACTGGTCGCAAAATTGATGACCCAGAGTTGTTAGAAGCAGTAAGACTGACAATTATAAA
CAACATGCTTGAGTATCATCCTGAAGCTAGCAGTCAATTGGCCATGGGTGCAACTTTTGGGCTAGAGCCCCCTACAGAAGTGGTTGATGTGGACATAGCA
ACTCACATAGAGATCTATGACGATGGTCCTG
page-top