Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2577
Contig Information
Length 960 bp
Tissue Liquid cultured tissue
Clones 50 Clones [Download: CSV  ,  FASTA ]
whvs1e06    whvs1e22    whvs1g20    whvs3p23    whvs4d06    whvs4m22    whvs5g01    whvs5k18    whvs5m16    whvs6p23    whvs7h02    whvs11g20    whvs11h02    whvs12f08    whvs13e19    whvs13j16    whvs14i03    whvs15m19    whvs16l22    whvs17i20    whvs18e03    whvs19m02    whvs20h13    whvs20i14    rwhvs1e06    rwhvs1e22    rwhvs1g20    rwhvs3p23    rwhvs4d06    rwhvs4m22    rwhvs5g01    rwhvs5k18    rwhvs5m16    rwhvs6p23    rwhvs7h02    rwhvs11g20    rwhvs11h02    rwhvs12f08    rwhvs13e19    rwhvs13j16    rwhvs13n16    rwhvs14i03    rwhvs15m19    rwhvs16l22    rwhvs18e03    rwhvs19m02    rwhvs19m14    rwhvs20h13    rwhvs20h14    rwhvs20i14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0612800 [Oryza sativa (japonica cultivar-group)] >gi|158513163|sp|A2YEZ6|SAP8_ORYSI RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 8; Short=OsSAP8; AltName: Full=Stress-associated protein 3 >gi|158513350|sp|A3BDI8|SAP8_ORYSJ RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 8; Short=OsSAP8; AltName: Full=Stress-associated protein 3 >gi|51090916|dbj|BAD35521.1| putative multiple stress-responsive zinc-finger protein [Oryza sativa Japonica Group] >gi|51090950|dbj|BAD35553.1| putative multiple stress-responsive zinc-finger protein [Oryza sativa Japonica Group] >gi|113596106|dbj|BAF19980.1| Os06g0612800 [Oryza sativa (japonica cultivar-group)] >gi|125597847|gb|EAZ37627.1| hypothetical protein OsJ_021110 [Oryza sativa (japonica cultivar-group)] >gi|215679046|dbj|BAG96476.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697574|dbj|BAG91568.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737658|dbj|BAG96788.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737696|dbj|BAG96826.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765570|dbj|BAG87267.1| unnamed protein product [Oryza sativa Japonica Group]
Score 737
Evalue 4.68156e-76
Total Hit Count 427
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2577
CCATTACCTGGTTGCGACTGTAAGACAGACAGACAGACGGACACCAGGAGGAAACAGGAGTACATTACAGAGTGCTAGCCAAAATGCGAAAGCCACAATA
CCGTTACCGTTCCGCCGCGCAGAGAGACGACCATAAATAAAGCTTACACAACATAGCCAACAAGGAGACCGTTCGGACCTGGGGCTGCCGCCGAGGCGCG
TGTGCCGTGCATCACGATTGCCCAACAACAACTAGGATTGCAGAAGCCAACATGATGAAAGGATAATGCAGCAAAGACGCACGATGACGAGGTAGCGCAG
ATTTGATTTGGGACCTTATGTTCTGCCGACCGTAGGGGGGCCCTTCCTAGATCTTGTCGAGCTTCTCCGCCTTCACCACCGGGTTGGCCTTGGCGATGGC
GTCCATGGCCGCGGCGCGGTAGTCAAACTTGCACTCATGCTTGTCCGAGTAACGGTGAGTCGCGCAGTAGAGGTTCCCGCACCGGCAGTTGAATCCGGTC
AGCCCGACCCTCTTTCTGCAGGTGCTGCACCGGCTTGGGCCTTTGGGGTTCTCCATCGCCGCCTCACTGGGACCGGCGATATCAGCAGGCTGTGCGGTAA
TAAGCATCTTCGCCTCTACGTGAGCAACTGCCACCGCCGTGTTGCCAGCAGCAAGATGTTCTTTCGCGGCATCACCACCGTTGACGATGCTGTCAAAAGA
GGAGGCGGCCAGCTTGGCCTGCTCCTGCTTCATCGCCATCTCCTTGTGGCACTTGGAGCACATGTTCATGGTCGCCGCACTGCCGAAGAAGCCGCAGTTA
TTGACGCAAAGGATGGGGCCCTCACGAGACTGGCAGCCGGTCTCCTTGTGCTCCATGACTTTGATTTAACTGATAGGAGGAAGCCCTCGTCGCGATTCCT
CTCCGGCGATCCCCTAGGAGGGGGAGGAACGAGGAGGCGAGGGGAGAGGAATCGCGAGGA
page-top