Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2569
Contig Information
Length 2128 bp
Tissue Liquid cultured tissue
Clones 29 Clones [Download: CSV  ,  FASTA ]
whvs1e08    whvs3m19    whvs4k01    whvs4m02    whvs4m13    whvs9p01    whvs14a20    whvs14l13    whvs14l14    whvs16i03    whvs17f07    whvs17h23    whvs17h24    whvs19d06    whvs19l04    rwhvs3m19    rwhvs4k01    rwhvs4m02    rwhvs4m13    rwhvs9p01    rwhvs14a20    rwhvs14l13    rwhvs14l14    rwhvs16i03    rwhvs17f07    rwhvs17h23    rwhvs17h24    rwhvs19d06    rwhvs19l04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 2003
Evalue 0
Total Hit Count 363
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2569
GGAGTCGTGGAGATGTACATGAGGAAGGAGCTGGAGCTGGAGAAGGGCACGCTATGCGTGATGTTGCACAAGAATTCCTCCCACCCCCACCGTCTCGCCG
CCGCCACCACAGCTAGATAAGAAAAAAAGAGAGAGCAGAACTCGTTGGGAGTGCTCGAGATCTGTGTCGGGAGAGGGGGAATTCTTGAGATCGGAATCGG
AACAAGCGGGCGCGCTCGGGATCGGGGTTACCATACAATTTTTCCCAGGAACCTTTAGTGAATGTGCTAATGGAGTCAAAGGGTGGCAAAAAGTCTAGCA
GTAGTAGTTCCCTGATGTACGAAGCTCCCCTCGGCTACAGCATTGAAGACGTTCGACCTGCTGGAGGCGCCAAGAAGTTCTCTGCTGCATACTCGAACTG
CGCGAAGAAGCCATCCTGATATCGTTTTTGGCATCCCCTTCCCGTAGTTTAGGATTTTTATGCAATTTTATTCTGACTCTTTTCTCCCACCAATCTCTCT
GGCCTGCTTCACGATAATCGACCAGTTCTCTAGTCTTACTCCCTCTGTTCCTCTCTGCTCTGCTTTCTGACTCAAACTGCAACAATGGCTGCCCCGACCT
CTGCAATCGGGTTCGAGGGCTACGAGAAGCGCCTCGAGATCACCTTCTCCGAGGCATCGATCTTTGCCGACCCTCATGGTCGTGGCCTGCGCGCCCTCTC
TAGGGCCCAGATTGACTCTGTTCTTGATCTTGCACGGTGCACCATTGTGTCCGAGCTCTCCAACAAGGACTTCGACTCGTATGTGCTATCTGAGTCCAGC
CTGTTCATCTATTCTCAGAAGATTGTGATCAAGACCTGTGGGACTACCATGCTCCTGCTCACCATTCCTAGGATTCTTGAGCTTGCTGAAGAGCTGTGCA
TGCCGCTTGCTGCCGTCAAGTACTCTCGTGGGATGTTCATCTTCCCCGGCGCACAGCCTGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTGAA
CCGCTACTTCGGCCACCTGAAGTCTGGTGGCAATGCTTATGTGATCGGAGACCCAGCGAAGCCTGGCCAGAAGTGGCACATCTACTATGCCACCGAGCAA
CCTGAGCAGCCCATGGTCACCCTGGAGATGTGCATGACTGGGCTGGACAAGAAGAAGGCCTCTGTCTTCTTCAAGACTCAAGCTGATGGCCACGTTTCCT
GTGCCAAGGAGATGACCAAGCTCTCTGGAATCTCTGACATTATCCCTGAGATGGAGGTCTGTGACTTCGACTTCGAGCCCTGCGGCTACTCCATGAACGC
CATCAACGGATCTGCCGTCTCCACCATCCATGTGACCCCCGAGGACGGCTTCAGCTACGCGAGCTACGAGGTCATGGGCATGGACGCCTCCGCCCTGGCC
TACGGCGACATCGTCAAGAGGGTCCTCCGGTGCTTTGGCCCTTCAGAGTTCTCTGTGGCGGTCACCATCTTCGGTGGCCGTGGCCACGCCGCCACCTGGG
GCAAGAAGCTCGAAGCTGAGGCATACGACTGCAACAACGTTGTGGAGCAGGAGCTCCCCTGCGGGGGCGTCCTCATCTACCAGAGCTTTGCCGCGAACGA
AGAGGTTGCTGTCTCTGCCGGGTCGCCCAGGTCCGTCTTCCACTGCTTCGAGGCCGAGAGTGTGCAGAGCCACCCTCTGGTCAAGGAAGGCAAGCTCGCC
AACCTCCTCGCATGGCGGGCGGAGGAGGATTCCCTGGAGGAGGGCGCGGTGCTGTGCGAGTGATTGGCTGTCGCTGTTCCGTCTGTGGACTTTGTTCTGA
CTAAGTTTGTCGTTTGGTTACTGTGAAGCAGCTGGCCAGGCTATTGCTACTCCGAATAAACTATTAGCTCTAGGTGGTTTGCTGCGTCTGCCACAATGAA
GCGTACTTCTGGGGAGAAGTTGTCTCAAACTGATAAATAAGCATTTTTTTTCTAAGACGAGTGTCACTTTGTTATCATATTCATGTTCTGTAATCGAAAC
TACTTCACAGCCGATAGCTGTTGGACGATTCAAGCACGATTCTTAATCTAGTGGCTGTGTTGCACCTAGTACTAGGTATCGATGGCCTGAATTGCAGTAT
CGTCCAACAATCGGCTGGAANCATGTCG
page-top