Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2565
Contig Information
Length 1545 bp
Tissue Liquid cultured tissue
Clones 28 Clones [Download: CSV  ,  FASTA ]
whvs1a03    whvs1i11    whvs2m06    whvs5c12    whvs5d03    whvs6j24    whvs8h05    whvs11a06    whvs15k09    whvs16i08    whvs18b17    whvs18n11    whvs10c12    whvs10c20    rwhvs1a03    rwhvs1i11    rwhvs2m06    rwhvs5c12    rwhvs5d03    rwhvs6j24    rwhvs8h05    rwhvs11a06    rwhvs13i05    rwhvs15k09    rwhvs16i08    rwhvs18b17    rwhvs18n11    rwhvs10c20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH1A [Triticum aestivum] >gi|119388731|gb|ABL74262.1| alcohol dehydrogenase ADH1A [Triticum turgidum subsp. dicoccon]
Score 1851
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2565
GTGAGTGAGAGATCAGTTCTCGATTTCNATTCCGGTTCCGCTCAGAGAATTCCCCAGGCGAGCGAGCGAGATGGCGACCGCCGGGAAGGTGATCAAGTGC
AAAGCCGCGGTGGCGTGGGAGGCGGGGAAGCCGCTGTCCATGGAGGAGGTGGAGGTGGCGCCGCCGCAGGCCATGGAGGTGCGCGTCAAGATCCTCTTCA
CCTCCCTCTGCCACACCGACGTCTACTTCTGGGAGGCCAAGGGCCAGACCCCCATGTTCCCTCGGATCTTCGGTCATGAAGCTGGAGGCATAGTGGAGAG
TGTTGGAGAGGGTGTGACTGAGCTTGCCCCTGGTGACCATGTCCTACCTGTGTTCACTGGGGAGTGTAAGGAATGCCCACATTGCAAGTCTGCGGAGAGC
AACATGTGTGATCTGCTCAGGATCAACACCGACAGAGGTGTCATGATCGGGGATGGCAAGTCACGCTTCTCTATTGACGGGAAGCCGATTTACCATTTCG
TAGGGACTTCCACCTTCAGTGAGTATACTGTCATGCATGTTGGTTGTGTTGCCAAGATCAACCCTGAGGCTCCCCTTGACAAAGTCTGTGTTCTTAGCTG
TGGTATTTCCACTGGTCTTGGCGCATCCATTAATGTTGCAAAACCACCAAAGGGTTCGACAGTGGCGATATTTGGGCTAGGAGCTGTTGGCCTTGCTGCT
GCAGAAGGTGCAAGGATTGCAGGTGCATCAAGGATCATTGGTGTTGACTTGAACGCCAGCAGATTTGAAGAAGCTAGAAAATTTGGCTGCACGGAATTTG
TGAACCCGAAAGATCACACCAAGCCAGTTCAACAGGTGCTCGCTGAGATGACAAATGGTGGAGTTGACCGCAGTGTTGAGTGCACGGGCAACGTCAATGC
TATGATACAAGCATTTGAATGTGTTCATGATGGCTGGGGTGTTGCTGTGCTGGTGGGTGTGCCGCACAAGGACGCCGAATTCAAGACCCACCCGATGAAC
TTCCTGAACGAGAGGACTCTCAAGGGCACCTTCTTCGGAAACTTCAAGCCGCGCACTGACCTGCCCAATGTCGTGGAGATGTACATGAGAAAGGAGCTGG
AGGTGGAGAAGTTCATCACACACAGCGTGCCGTTCTCGGAGATCAACAAGGCGTTCGACCTCATGGCGAAGGGCGAGGGCATCCGCTGCATCATCCGCAT
GGAGAACTAAGCCGCCTCACGCGCTTCTGATCGCTCCGATGTAATAAGCGCTGGGGTGCGGTTTCTGAACAAGATCATCGTCTGTGGTTTCGCCTTCCTT
GGCAAAGTAGCGTAGTATTAGTTCAAGTATATCTGTAATTACGTACCGGACAAGTGGCTGTACTACGAACGAGCTCTCTTTTGGCAGCAATATATGCTGC
TGCTACTACTACTATGGCCATGAGTTTCAGTTGAATGAGTCTGTTCTTAGCCTATCTGATGTTTCAATGTCCCGTTGCTTTACTTTTCAGTTTTTCCTTT
ACTGCTCTGCTTGGCTGACTCTGCTGGGACCGTGCTTATGCTAAT
page-top