Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2563
Contig Information
Length 808 bp
Tissue Liquid cultured tissue
Clones 26 Clones [Download: CSV  ,  FASTA ]
whvs1c11    whvs1c12    whvs1m03    whvs2j10    whvs4j22    whvs7d10    whvs7k06    whvs8d10    whvs8g17    whvs11j22    whvs14l16    whvs18c05    rwhvs1c11    rwhvs1c12    rwhvs2j10    rwhvs4d08    rwhvs4j22    rwhvs4n02    rwhvs5c19    rwhvs7d10    rwhvs7k06    rwhvs8d10    rwhvs8g17    rwhvs11j22    rwhvs14l16    rwhvs18c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0569200 [Oryza sativa (japonica cultivar-group)] >gi|77556849|gb|ABA99645.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649578|dbj|BAF30090.1| Os12g0569200 [Oryza sativa (japonica cultivar-group)]
Score 467
Evalue 7.10448e-45
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2563
TTTTTTTTTTGTAAATNAGATTTTATAAANTAGAAAACACAACACACCAACGACGGATACAGAGCTGACGACATGCAGTTCATTGCACGGCCATGAAACA
TCTCTAGCCACGCATTCACCACCGCAACTACTAATTGAACAGCAAATCCGACACAACGCGACACGACAGTACAATAGCTCCTTGGAGCAGATGATAACTA
ACTAGCAGCTGCAGTACGACTAAGATCACCGAGCAGCAAACTTATTAAACACACCCAGCAGCTGGATCTAGGGGTTGTAGTAGACGATCTTGATCTCGTC
GACGCCGTGGCACTTGCCGCCGGGGACGGAGTGCTCGAAGCAGTGGCCACCGCTGTTGCAGCCGGCGGTGGGGCAGTGGTCTTTCAGGGGGTGGCCGTGG
GGGGTGATGGAGACACGGATGGGCATGTGCGACTGGTCGGTGCTCACCTGGTACCACGCCCCGCCGTCGTACCCGATGTGGAACTCCGTCACCACGGCGT
CCTGCACCTTCACGCGCCCCGTCCACGAGCACACGTCGTACGACACGTGGGTGCCGTGGCGGAGCAGGTGGCCAGGGCTGTAGAGCAGCTTGCTGTTGGC
CAGCGGCTCGATGCCGAGGTAAAGGTCCTTGCCGCACAGGTTCTGCACCGTAACCTTGCGGCTCGGCTTGCAGTTTTGGGGATCCTGACCGGCGGCGGAC
ATGGCAGTCGCTGCCAGCGCCACGGCGAGGAGGAGAGCCGCCACGGGCTTGGAGAACGCCATTGGCTGTTACTCGCTGGTTAGGAGTGAAGAGGAGTGAC
TGATGCCG
page-top