Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2562
Contig Information
Length 1474 bp
Tissue Liquid cultured tissue
Clones 25 Clones [Download: CSV  ,  FASTA ]
whvs1d15    whvs5g11    whvs9g18    whvs9h05    whvs12i07    whvs13c21    whvs15d06    whvs16m19    whvs16o04    whvs17j06    whvs19h13    whvs20b11    whvs20p23    rwhvs1d15    rwhvs3n21    rwhvs5g11    rwhvs9g18    rwhvs9h05    rwhvs13c21    rwhvs15d06    rwhvs16m19    rwhvs16o04    rwhvs19h13    rwhvs20b11    rwhvs20p23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH1D [Triticum aestivum]
Score 1845
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2562
TCAGTTCTCGATTTCGATTCCGGGCTCAGAGAATTTCCCAGGCGAGCGAGATGGCGACGGCCGGGAAGGTGATCAAGTGCAAAGCCGCGGTGGCATGGGA
GGCGGGGAAGCCGCTGTCCATGGAGGAGGTGGAGGTGGCGCCGCCGCAGGCCATGGAGGTGCGCGTCAAGATCCTCTTCACCTCCCTCTGCCACACCGAC
GTCTACTTCTGGGAGGCCAAGGGGCAGACCCCCATGTTCCCTCGGATCTTCGGTCATGAAGCTGGAGGCATAGTGGAGAGTGTTGGAGAGGGTGTGACTG
AGCTTGCCCCTGGTGACCATGTCCTTCCTGTGTTCACTGGGGAGTGTAAGGAATGCCCACATTGCAAGTCTGCGGAGAGCAACATGTGTGATCTGCTCAG
GATCAACACCGACAGAGGTGTCATGATCGGGGATGGCAAGTCACGCTTCTCTATTGACGGGAAGCCGATTTACCATTTCGTAGGGACTTCCACCTTCAGT
GAGTATACTGTCATGCATGTTGGTTGTGTTGCCAAGATCAACCCTGAGGCCCCCCTTGATAAAGTCTGTGTTCTTAGCTGTGGTATTTCCACTGGTCTTG
GTGCATCCATTAATGTTGCAAAACCACCAAAGGGTTCGACAGTGGCGATATTTGGGCTAGGAGCTGTTGGCCTTGCTGCTGCAGAAGGTGCAAGGATTGC
AGGTGCATCTAGGATCATTGGTATTGACTTGAACGCCAGCAGATTTGAAGAAGCTAGAAAATTTGGCTGCACGGAATTTGTGAACCCGAAAGATCACAGC
AAGCCAGTTCAGGAGGTGCTCGCTGAGATGACAAATGGTGGAGTTGACCGCAGTGTTGAGTGCACGGGCAACGTCAATGCTATGATACAAGCATTTGAAT
GTGTCCATGATGGCTGGGGTGTTGCTGTGCTGGTGGGTGTGCCGCACAAGGACGCCGAATTCAAGACCCACCCGATGAACTTCCTGAACGAGAGGACTCT
CAAGGGCACCTTCTTCGGAAACTTCAAGCCGCGCACCGACCTGCCCAATGTCGTGGAGATGTACATGAGAAAGGAGCTGGAGGTGGAGAAGTTCATCACA
CACAGCGTGCCGTTCTCGGAGATCAACAAGGCGTTCGACCTCATGGCGAAGGGCGAGGGCATCCGCTGCATCATCCGCATGGAGAACTAGGCCGCCTCAC
GTGCTTCTGATTGCTCCGATGTAATAAGCGTTTGGGGGGCGGTTTCTGAACCAGATCATCGTCTGTGGTTTCGCCTTCCTTGGCAAAGTAGCGTAGTGTT
AGTTCAAGTATATCTGTAATTACGTACCGGAGAAGTGGTGGTAACTACGAGCTCTCTTTTGGCAGCAATATATGCTGCTGCTGCTGCTGCTGCTGCTGCT
ACTATGGCCATGAGTTTCAGTTGAATGAGTCTGTTCTTAGCCTACTTGATGTTTCAATGTCCCGTTGCTGCTGC
page-top