Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2553
Contig Information
Length 1068 bp
Tissue Liquid cultured tissue
Clones 23 Clones [Download: CSV  ,  FASTA ]
whvs1b10    whvs2d03    whvs2e10    whvs6g09    whvs9b24    whvs11d05    whvs11o21    whvs15d01    whvs15p06    whvs15p16    whvs19l02    whvs19n05    whvs20f24    rwhvs1b10    rwhvs2d03    rwhvs2e10    rwhvs6g09    rwhvs11d05    rwhvs11o21    rwhvs15d01    rwhvs17c18    rwhvs19n05    rwhvs20f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.17762e-132
Total Hit Count 434
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2553
CCGGCGGCGGCGCGTTGCACAGGAGAAGGAGCAGGCGGCGGCGGTGCCCGAAGAGGAGAAGCACGGCGACCTAGCCCGAGCTCGCAACCATGGCTAGGGG
TTTGAAGAAGCATCTGAAGAGGCTCAATGCCCCGTCTCATTGGATGCTTGACAAGCTTGGTGGAGCTTTTGCCCCCAAGCCATCATCCGGTCCTCACAAG
GCCAGGGAGTGCCTGCCTCTGATCCTCATCCTGAGGAACAGACTGAAATATGCTCTCACCTACCGTGAAGTGCAATCTATCCTTATGCAGCGTCATATTA
TGGTTGATGGAAAGGTCCGCACTGACAAGACCTACCCTGCTGGTTTCATGGACATCATTTCCATTCCCAAGACTGGTGAGAACTACAGGCTTCTGTATGA
CACCAAGGGTCGCTTCCGCCTTCACTCTGTCAGGGACGAGGATGCTAAGTTCAAGCTCTGCAAGGTCAGGTCTGTCCAGTTTGGCCAGAAGGGCATCCCA
TACCTCAACACCTATGATGGCCGCACCATCCGCTACCCAGACCCACTCATCAAGGCCAATGACACCATCAAGCTTGACCTGGAGACCAACAAGATTGTTG
ACTTCATCAAGTTTGACGTCGGCAACGTGGTCATGGTGACTGGTGGGCGCAACACTGGGCGTGTTGGTGTGATCAAGAACAGGGAGAAGCATAAGGGAAC
CTTCGAGACCATCCACGTTGAGGATGCCCAGGGCCACCAGTTCGCCACCCGTCTGGGCAACGTGTTCACCATCGGCAAGGGCACCAAGCCGTGGGTGAGC
CTCCCCAAGGGCAAGGGTATCAAGCTCACCATCATTGAGGAGCAGAGGAAGCGGGATGCCGCTGCCCAGGCTGCTGCCAAGGCCTGATTCTGAGGTGTTG
AGTCGTTTTGCTATAGCCAGTTATCTGCAAGGATATAGACCTATGTTCCTGGAACCATCGTTTTTAAGTTTTGCCTGATGTTTGTTGATTTGCGAACTCG
TGGTTGCTGCTAGATGTAATGTGGATGTTTACCTTATTAAGCGCTATTTCGAGACCTCAAAAAAAAAA
page-top