Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2561
Contig Information
Length 1034 bp
Tissue Liquid cultured tissue
Clones 25 Clones [Download: CSV  ,  FASTA ]
whvs1c22    whvs1d09    whvs1k12    whvs3a13    whvs5b24    whvs5o09    whvs6n21    whvs12i08    whvs14e10    whvs16c03    whvs18g04    whvs18k18    rwhvs1c22    rwhvs1d09    rwhvs1k12    rwhvs3a13    rwhvs5b24    rwhvs5o09    rwhvs5o10    rwhvs6n21    rwhvs9g22    rwhvs14e10    rwhvs15o19    rwhvs16c03    rwhvs18k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 3.96779e-132
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2561
AGATAAACATCCACATTACATCTAGAGGCAACCACGCAGTTCGCAAATCAACAAACATCAGGCAAAACTTAAAAACGATGGTTCCAGGAACATAGTTCTA
TATCCTTGCAGATAACTGGCTATAGCAAAACGACTCAACGCCTCAGAATCAGGCCTTGGCAGCAGCCTGGGCAGCGGCATCCCGCTTCCTCTGCTCCTCA
ATGATGGTGAGCTTGATACCCTTGCCCTTGGGGAGGCTCACCCATGGCTTGGTGCCCTTGCCAATGGTGAATACATTGCCCAGACGGGTGGCGAACTGGT
GGCCCTGGGCATCCTCAACGTGGATGGTCTCGAAGGTTCCCTTATGCTTCTCCCTGTTCTTGATCACACCAACACGCCCAGTGTTGCGCCCGCCAGTCAC
CATGACCACGTTACCAACGTCGAACTTGATGAAGTCAACAATCTTGTTGGTCTCCAGGTCGAGCTTGATAGTGTCATTGGCCTTGATGAGAGGGTCTGGG
TAGCGGATGGTGCGGCCATCATAGGTGTTCAGGTAGGGGATGCCCTTCTGGCCGAACTGGACAGACCTGACCTTGCAGAGCTTGAACTTAGCATCCTCAT
CCCTGACAGAGTGAAGGCGGAAGCGGCCCTTGGTGTCATACAGAAGCCTGTAGTTCTCACCAGTCTTGGGAATGGAAATGATGTCCATGAAACCAGCAGG
GTAGGTCTTGTCAGTGCGGACCTTTCCATCAACCATGATATGACGCTGCATAAGGATAGACTGCACTTCACGGTAGGTGAGAGCATATTTCAGTCTGTTC
CTCAGGATGAGGATCAGAGGAAGGCACTCCCTGGCCTTGTGAGGACCAGATGATGGCTTGGGGGCAAAAGCTCCACCAAGCTTGTCAAGCATCCAGTGAG
ACGGGGCATTGAGCCTCTTCAGATGCTTCTTCAAACCCCTAGCCATGGTTGCGAGCTCGGGCTAGGTCGCCGTGCTTCTCGTCTTCGGGCACCACCGCCG
CCTGCTCCTTCTCCTGTGCTACGCGCCGCCGCCC
page-top