Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2548
Contig Information
Length 1583 bp
Tissue Liquid cultured tissue
Clones 20 Clones [Download: CSV  ,  FASTA ]
whvs1e20    whvs2d23    whvs5n10    whvs8j04    whvs9i19    whvs9k01    whvs12j06    whvs16o07    whvs16o08    whvs18c17    rwhvs1e20    rwhvs2d23    rwhvs5n10    rwhvs8j04    rwhvs9i19    rwhvs9k01    rwhvs12j06    rwhvs16o07    rwhvs16o08    rwhvs18c17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2548
TTTTTTTTTTGCAATCTAATAACTTGCATTTCACAACAGATCAGTCTCAAGGCACAGGAGTTTAGCCGAAGCAGGAATAGAAATACAGTAATTAAACGAC
AGACAGGATCATTGCTCGCCCGGGATAAGAGTCTGCAGCAACAAAAGCAATGACCATGAACAAAAACCTTCTGCTAGATAGATGCCTATTTCTTCTTGAT
GGCAGCCTTGGTAACCTTGGCGCCGGTGGGGTCCTTCTTCTCCACGCCCTTGATGACACCAACAGCAACCGTTTGTCTCATGTCACGCACAGCGAAGCGG
CCAAGAGGAGGGTAGGTGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCGTCACCGTTCTTCAGGAACTTGGGCAGCG
CCTCCAGCTCCTTACCAGATCGCCTGTCGATCTTAGTCACCAGCTCAGCAAACTTCACAGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCC
GTTGCCGATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCTGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCA
CGCTTCAGATCCTTAACAGCAACGTTCTTCACGTTGAAGCCAACATTGTCACCAGGAAGCGCCTCCAGGAGGGACTCGTGGTGCATCTCAACGGACTTGA
CCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGCCAACAGGCACAGTTCCAATGCCACCAAT
CTTGTAAACGTCCTGAAGGGGAAGACGCAGGGGCTTGTCTGAGGGCCTCTTGGGCTCGTTGATCTGGTCAAGAGCCTCAAGAAGGGTAGGGCCCTTGTAC
CAGTCAAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCAAACCCAGAGATGGGAACAAAGGGAACCTTGTCAGGGTTGTAGCCGACCTTCTTCAGGT
ACGAAGAGACTTCCTTGACAATTTCCTCATAACGGGCCTTTGAGTACTTGGGAGTGGTGGCGTCCATCTTGTTACAGCAGCAGATCATCTGCTTCACTCC
AAGAGTGAAAGCAAGGAGGGCATGCTCACGGGTCTGGCCATCCTTGGAGATACCAGCCTCAAAACCACCAGTGGTGGAGTCAATGATGAGCACAGCACAG
TCAGCCTGGGAGGTACCAGTAATCATGTTCTTGATGAAGTCACGGTGACCAGGAGCATCAATGACGGTGCAGTAGTACTTGGTGGTCTCGAACTTCCACA
GGGCAATATCAATGGTGATACCCCTCTCACGCTCGGCCTTCAGCTTGTCAAGCACCCAGGCGTACTTGAAAGACCTCTTGTTCATCTCGGCGGCTTCCTT
CTCGAACCTCTCGATCACACGCTTGTCAATACCTCCAAGCTTGTAGATCAGATGGCCAGTGGTGGTCGACTTGCCAGAGTCGACATGGCCAATGACCACG
ATGTTGATGTGAGTCTTCTCTTTACCCATGGCTGAAGCTCCGAGGAAGGAGAAGGAACCGAGAGGAGGCGGCGGCGGGGATGG
page-top