Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2547
Contig Information
Length 1922 bp
Tissue Liquid cultured tissue
Clones 20 Clones [Download: CSV  ,  FASTA ]
whvs1c06    whvs1i03    whvs2c07    whvs2e22    whvs2g04    whvs9k09    whvs13a18    whvs13b05    whvs13h08    whvs18b24    whvs10b05    whvs10g23    rwhvs1c06    rwhvs2c07    rwhvs9k09    rwhvs13a18    rwhvs13h08    rwhvs18b24    rwhvs10b05    rwhvs10g23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase [Triticum monococcum]
Score 1964
Evalue 0
Total Hit Count 375
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2547
CGCGCTAACTCGTTGCACAAGAATTCCTCCCACCCTCGCCGTCTCGCCGCCGTCACCACCGCAGCTAGATAAGAGAAAAAAAGAGAGAGAAGAACTCGTC
GGGAGGGCTCGAGATCTGTGTCGGGAGAGAGGGAATTCTTGAGATCGGAATCGGAACAAGCGGGCGCGCTCGGGATCGGGGTTACCATACAATTTTTCCC
AGGAACCTTTAGTGAATGTGCTAATGGAGTCAAAGGGTGGCAAAAAGTCTAGCAGTAGTAGTTCCCTGATGTACGAAGCACCCCTCGGCTACAGCATTGA
AGACGTTCGACCTGCTGGAGGCGCCAAGAAGTTCTCTGCTGCATACTCGAACTGCGCGAAGAAGCCATCCTGATATCGTTTTTGGCATCCCCTTCTCGTA
GTTTAGGATTTTTATGCAATTTTATTCTGACTCTTTTCTCCCACCAATCTCTCTGGCTTGCTGCTTCACGATAATCGACCAGTTCTCTAGTCTTTCTCCC
TCTGTTCCTCTCTGCTCTGCTCTCTGACTCAAAACTGCAACAATGGCTGCCCCGACCTCTGCGATCGGATTTGAGGGCTACGAGAAGCGCCTTGATATCA
CCTTCTCTGAGGCATCAATCTTTGCTGACCCTCATGGTCGTGGCCTGCGCGCCCTCTCCAGGGCCCAGATTGACTCTGTTCTTGATCTTGCACGGTGCAC
CATTGTGTCCGAGCTCTCCAACAAGGACTTTGACTCGTACGTGCTATCCGAGTCGAGCTTGTTTATCTACTCTCAGAAGATTGTGATCAAGACCTGTGGG
ACTACCATGCTCCTGCTCACCATTCCAAGGATTCTCGAGCTGGCTGAAGAGCTGTGCATGTCGCTTGCTGCTGTGAAGTACTCCCGTGGGATGTTCATCT
TCCCCGGTGCACAGCCTGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTGAACCGCTACTTTGGCCACCTGAAGTCTGGTGGCAATGCCTATGT
GATTGGAGACCCAGCGAAGCCTGGCCAGAAGTGGCACATCTACTATGCCACCGAGCAACCTGAGCAGCCCATGGTCACCCTGGAGATGTGCATGACTGGG
CTCGACAAGAAGAAGGCCTCTGTGTTCTTCAAGACTTCTGCTGATGGCCATGTCTCCTGTGCTAAGGAGATGACCAAGCTCTCTGGTATCTCTGACATCA
TCCCTGAGATGGAGGTCTGTGACTTCGACTTCGAGCCCTGCGGCTACTCCATGAACGCCATCAACGGATCTGCCTTCTCCACCATCCATGTGACCCCCGA
GGACGGCTTCAGTTACGCGAGCTACGAGGTCATGGGCATGGACGCTTCGGCCCTGGCCTATGGCGACATCGTCAAGAGGGTCCTCCGGTGCTTTGGCCCT
TCAGAGTTCTCAGTGGCGGTCACCATCTTCGGTGGCCGCGGCCATGCCGCCACCTGGGGCAAGAAGCTCGACGCCGAGGCATACGACTGCAACAACGTTG
TGGAGCAGGAGCTCCCCTGTGGAGGCGTCCTCATCTACCAGAGCTTTGCCGCGAACGAAGAGGTTGCTGTCTCTGCCGGGTCGCCCAGGTCCGTCTTCCA
CTGCTTCGAGGCCGAGACTGTGGAGAGCCACCCGCTGGTCAAGGAAGGCAAGCTCGCCAACCTCCTCGCATGGCGAGCGGAGGATTCTCTGGAGGAGGGC
GTGGTGCTGTGCGAGTGATTTGCTGTCGAATGTTCAGTCTGTGGAATTTGCTCTGACTGTTTGTCTTTTGTCGTTTGGTTACTGTGAAGCAGCCGGCCAG
GCTATTGCTCTCTGAATAAACTATTAGCTCTAGGTGGTTTGCTGCGTCTGCCACAATGAGCATACTGTTTGGGGAAAAGTTGTCTCAACTTATAAATAAG
CATTTTTTTTCTAAAAAAAAAA
page-top