Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2539
Contig Information
Length 518 bp
Tissue Liquid cultured tissue
Clones 17 Clones [Download: CSV  ,  FASTA ]
whvs1f09    whvs4f09    whvs6j17    whvs15j04    whvs15j15    whvs15j16    whvs16n08    whvs20k18    rwhvs1f09    rwhvs4f09    rwhvs6j17    rwhvs7b23    rwhvs15j04    rwhvs15j15    rwhvs15j16    rwhvs16n08    rwhvs20k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 186
Evalue 9.77342e-13
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2539
TTTTTTTTTTCCCCAATTCAGAAATAAGCGCAGTACAAATGTTTGCAATTCAGTAAACTACATCATGGGTATATACAAGTGACGAATCAATACTGAAATT
GACTCAGGGGAGGAGGAGTGGGGATACAGGTAAAACTCCTCCAAATTAACTCCATTTCAGAAAGAAGGAGATGACTAATTAAGCAGAGAATAAGCCGTCA
AAGGCTGCCATGGCGACCGGTGCCTTCGGCTCGGCGACGTCCGCCTTGACGAGCAGCGCGACGCGCACCTTGACCCCCGACGCCCAGGAGCCCCACACCT
TGGCCACGGCCCCGAAGTTCTCCCGTCCTTTGGACGCCTCCTCGCCGGCGCCGGCGAAGGGCGCCCCTCGCTGCAGCCTCTTCTCGAACGCCTCGTCGGC
CACCAGCATCGCTATGTCCGCCATTGGCAAGCGACCGAAAAACCACTCGAACCAGATGGAAACTGAAACTGAACCTGCTGTTGCTCTGGAATGGATGAGA
GAGAGAACTAGTCTCGAG
page-top