Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2525
Contig Information
Length 1461 bp
Tissue Liquid cultured tissue
Clones 15 Clones [Download: CSV  ,  FASTA ]
whvs1e18    whvs3h13    whvs4d10    whvs4d22    whvs4o20    whvs4p07    whvs11f22    whvs18f22    rwhvs1e18    rwhvs3f02    rwhvs3h13    rwhvs4o20    rwhvs4p07    rwhvs11f22    rwhvs18f22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1-gamma [Oryza sativa Japonica Group]
Score 1540
Evalue 6.69265e-169
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2525
CGCCCGCTGAGGTTTCCGCCGCGATCTCGTCTCGATCCGCACTCTCTATCTGAGATTTGGAATCGGGTGAAGCCTGCAGCTCCTGCCGACATGGCGCTCG
TTTTGCATTCAGGCAGCGGCAACAAGAATGCCTTCAAGGCACTTATTGCTGCAGAGTACTGTGGGGTCAAGGTTGAGCTCCCCAAGAACTTCGAGATGGG
TGTATCAAACAAAACCCCTGAATTCATCAAGATGAACCCCCTTGGGAAGGTTCCTGTTCTTGAGACTCCTGATGGTGCTGTTTTTGAGAGCAATGCTATT
GCACGCTATGTTGCTCGCTCAAAGGGTGACAACCTGCTTTGGGGTGGTTCTCTTATTGAATATGCACGTGTTGAGCAATGGATGGACTTTGCTGCCACAG
AGGTTGATCCCAATATCGCAAGGTGGTTGTACCCAAGGCTTGGTTATAGGGCTTTCAATGCCCAGGATGAGGAATTCGGCATTGCTGGATTAAAGAGGGC
CCTTGAAGCATTGAACACACACCTGGCATCAAACACATTCCTTGTTGGGCATTCTGTCACTCTGGCTGATATTGTCATGACATGCAACCTCTACCATGGT
TTTGCTCGGATCTTGACCAAGACTTTCACATCTGAGTTCCCTCATGTTGAGAGGTACTTCTGGACCATGGTTAACCAGCCTAACTTCAAGAAGGTCATTG
GCGAATTCAAGCAGGCAGAGGTTGTACCTCCTGTTCAGAAGAAGGCTGCTCCTGCTAAACAAAAGGAGGCCAAGAAAGAGGCTCCCAAGGCGGCCCCAAA
GCCAGCAGTAGTTGAGGCACCAGAGGAAGAGGCACCAAAGCCTAAGCCCAAAAATCCCCTTGATCTACTGCCACCAAGCAAGATGGTACTTGATGACTGG
AAGAGGCTATACTCAAACACTAAGAGCAACTTCCATGATGTTGCTGTTAAAGGTTTCTGGGAGATGTATGACCCAGAGGGCTACTCTCTGTGGTTCTGTG
ACTACAAGTACCAGGAAGAGAACACCGTGTCGTACGTGACCCTGAACAAGGTCGGCGGGTTCCTGCAGCGGATGGATCTGTGCCGCAAGTATGCTTTTGG
CAAGATGCTCGTGATTGGTTCTGAGGCGCCCTTCAAGGTCAAGGGGCTGTGGCTCTTCCGTGGGCAGGACATCCCTGAGTTCGTCATGAAGGAGGTCTAT
GACATGGAGCTCTACGAGTGGACCAAGGTTGACCTCTCTGACGAGGCCCAGAAGAAGCGCGTGGAAGCCATGATCGAGGACCTTGAGCCGTTCGAGGGGC
AGGCCTTGCTGGACGCCAAGTGCTTCAAGTAAGCGGAGCAGTGCTTGGGATCGTGACGGTGGCAAAGAACCTATCTAGGACTTGAAATTCAGTGTCGAAA
CAGTTGGTCTTTTTTTGGAATAGTTTGCTTGTTACTTAATGGCTATTTGACCCTGGTGAAC
page-top