Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2511
Contig Information
Length 945 bp
Tissue Liquid cultured tissue
Clones 12 Clones [Download: CSV  ,  FASTA ]
whvs1c24    whvs8c04    whvs12n01    whvs12n02    whvs12n13    whvs17m20    rwhvs1c24    rwhvs8c04    rwhvs12n01    rwhvs12n02    rwhvs12n13    rwhvs17m20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L13a [Triticum aestivum]
Score 988
Evalue 3.5753e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2511
CCCCCCGAACTCCAAACCCTAGTAGCGCCGCCGCCGCCAGGTAAGAGGCGAGATGGTGTCCGGCTCCGGCGTGTGCGCCAAGCGAGTGGTGGTGGACGCC
CGCCACCACATGCTCGGCCGCCTGGCCTCGATCGTCGCCAAGGAGCTGCTCAACGGGCAGCGCGTGGTGGTGGTCCGATGCGAGGAGATCTGCATGTCCG
GCGGCCTCGTCCGCCAGAAGATGAAGTACCTCCGCTTCCTCCGCAAGAGGATGAACACCAAGCCCTCCCACGGCCCCATCCACTTCCGCGCCCCGGCCAA
GATCCTCTGGCGCACCATCCGCGGTATGATTCCGCACAAGACCGCGAGGGGCGAGGCCGCGCTCGCCAGGCTCAAGGCGTACGAGGGCGTGCCGCCGCCG
TACGACAGGACCAAGCGCATGGTCATCCCCGACGCGCTCAAGGTTCTGAGGCTGCAGCCTGGGCACAGGTACTGCCTCCTCGGCCAGCTCTCCAAGGAGG
TCGGATGGAACTACGCCGACACCATCAGGGAGCTGGAGGAAAAGAGGAAGGAGAAGGCCAAGATCTCCTATGACAGGAGAAAGCAACTGGCGAAGCTCCG
CGTCAAGGCCGAGAAGGCAGCCGAAGAGAAGTTGGGAACTCAGCTGGAGATCCTGGCCCCTATCAAATACTAAGAGATATCAGAGCTTTCGTGCGCCATC
AGTTTTGGGAAACCTCTGTCGTATTTTAAGTAGTTTGGTAACTCTGATAGTACAATCTGGTTGGTAAACCTTTGTTATGCATGCAGTTCTGCTACCCTCA
TTTGAAATTTTCTACTTGGTGAACTGTTTCGTTTATCAAATGTGTGCATTTGGAGATTCTAGTGAATGTCTATCAGGTGATTATATGTTGCTGAGGCTGT
TTCTCTTTACTACAGCCCATGGCAGTCTCTTGACCTATCGTGAAA
page-top