Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2500
Contig Information
Length 639 bp
Tissue Liquid cultured tissue
Clones 11 Clones [Download: CSV  ,  FASTA ]
whvs1c07    whvs6e20    whvs7j17    whvs18f15    whvs18f16    whvs19e03    rwhvs1c07    rwhvs6e20    rwhvs7j17    rwhvs18f16    rwhvs19e03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal Pr 117 [Triticum aestivum]
Score 670
Evalue 1.29189e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2500
CCGGGTACCACCCCCTCTTCCAAGATGTCGAAGCGAGGGCGCGGAGGTTCTGCTGGTAACAAGTTCCGGATGTCGCTGGGTCTGCCGGTGGCAGCCACTG
TCAACTGTGCTGACAACACTGGTGCCAAGAACCTGTACATCATCTCCGTGAAGGGAATCAAGGGGCGCCTCAACAGGCTTCCTTCTGCCTGCGTTGGTGA
CATGGTTATGGCCACTGTCAAGAAGGGAAAGCCTGACCTCAGGAAGAAGGTCATGCCGGCTGTCATCGTCAGGCAGCGCAAGCCGTGGCGCCGAAAGGAC
GGTGTCTTCATGTACTTTGAAGACAATGCTGGAGTCATTGTGAACCCAAAGGGAGAGATGAAAGGTTCTGCCATCACTGGACCGATCGGGAAGGAGTGCG
CCGACCTGTGGCCCAGGATTGCCAGCGCCGCGAATGCCATCGTCTGATCTGATCGCCGGAGCAGCTAGATGATCAAAGCTTTTGATAGCATGTCCCTCTT
TTCTTCTAGTTTACTTGTGGCCCTTGAGGATGAGTTTCCTGGATTATGTAATGCTGCTGGATTATTGTCTGTTAGGTTTAAGATTTTGCACTGTGGTTTG
GCTGCTAAGATTTGTTCAGTTTGAACCTGAAAAAAAAAA
page-top