Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2494
Contig Information
Length 1496 bp
Tissue Liquid cultured tissue
Clones 11 Clones [Download: CSV  ,  FASTA ]
whvs1d21    whvs1d22    whvs3k24    whvs5d13    whvs12n14    rwhvs1d21    rwhvs1d22    rwhvs3k24    rwhvs5d13    rwhvs12n14    rwhvs15m17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08713 [Oryza sativa Indica Group]
Score 1773
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2494
CATAATATCAGTCGGATTGGAGGACAATGTATTTAAGGAAAATTGCCCAGTAACGATTCAGGGCACATACTCGAACTCAAACTCAACCCCTATGATAGTA
AATGTTTTGAGAACGCTGCCGCCAACCTACGACAACCTCTGGAGTTCGATGCCTCCACCAAAAACGAATGTTGGGAAAATCCACCCTCTACAGAAATTAT
TGCCTTCCAACGTTAAAAAGATAAAAGTTCGCCAGATCCTTGAAGGGCAGGACTGGGAACAGACTTCTCTTGTTCGTCATCATTTCTTCCCCTCTAGGCA
CCGCCTGAGCCGTACTTCTTGCCGAAGAAGAGGATCTGGAGCTGATCGTAGCCGGAGAGCACACCAGCACCAGCAATGGCACGGAGGATGTTGGCACCAG
CACCCTTGAAGAGAGACTTGGCACCCTCCTTCGCCAGGATCTGCTGGAAAGCATCCAAGGAGCTCTTGTACTTGACAGCCTCTCCGGAGGTCATCATCAT
CCTTCTGCGGACGGTGTCAATGGGGTAAGATGCAAGACCGGCACCGTTGGTGATCAACCAACCAAGAGCAAAGCTGGCAAAGAAGTTGTCCTGGAGAGTG
CCAGTGAGGAGAACGGGCTTCAGAGAATCATACAGTCCAAAGTACAGACCACGGTAGACAATGATTCCAACACAAGAGATGTTGAATCCACGGTAAAGCC
CAGCAATACCATCTGACTTGAGAGTCTTGCGGTAGACATCAACCAGGCCATTGAATTGCCTCTCACCTCCACCCTTGGATGCCTTTGCGTCATTGGCCAG
CCTTGTCCTAGCATAGTCCAGGGAGTACACGAAGAAGAGCGAGGAAGCACCAGCAGCACCACCAGAAGCAAGGTTGCCACCGAACCACTTCCAGTAACCA
TCCTTGTCCTTCTTGAAGTTGAACATCCTCTTGAAGTAATCCTTGAATGCAAAGTTCAAAGCCTGAGTTGGGAAGTAACGGATGACGTTAGCAGTGTTTC
CTCTCCACAATGAGCCAAAGCCTTCATCCTTGATGGTGCGGCCAAAGCAGTCACCAATACCCTTGTATGGCTCAGAGAGCCTGCCAGCCTTGATCATCTC
ATCCTGGTTCTGGATAAGCAGCTTAACACGCTCAATAGGAGCTGCAGCAGTCTTGGAAACTGCAGCGGACACTCCTCCCATGAGGAAGTCAATTGCAAAG
TTCTTGACACCTTTCTTCTCAGGTGGTGCATTGGCAAACAATGGAGAAGATGACATCATGGGGACACTGATGCCAAGGTTCTGAGTCATGTAGCAGCTTG
TGGTGAAGCGCCTCTCATAGGATGGCACAGAAGGGCAGATGTTGCGAGCACGAACACCCTCAGAGAAGCTGGAGGCAAGGTGGAACTGTCCACCAAACTT
CTGCATGACAGACGGGTGGTTAGCACGGTCCGCCATCTCTGACCCTTCGGAAGCGGAGGCGAGGAAGATGGGGTGGTGGCTCTTCCCGGCTCGGCG
page-top