Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2495
Contig Information
Length 927 bp
Tissue Liquid cultured tissue
Clones 11 Clones [Download: CSV  ,  FASTA ]
whvs9n22    whvs15i13    whvs15i14    rwhvs1c20    rwhvs2c24    rwhvs3d10    rwhvs9g17    rwhvs9n22    rwhvs13j19    rwhvs15i13    rwhvs15i14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH2A [Triticum aestivum]
Score 925
Evalue 7.05256e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2495
TTTTTTTTTTAACACAGAAATTGCACGCTGTACTATTGTGCCATAATTATTAATAGTAATTTACATGCTAACTGAAAGCTGCCGACAGACACAATGAAAC
CAAAGACCAAACCGTGAACACTAAACAAAGAGCATAGATGCACATCTCACGACTAGCAAACACGATTATTACGCGAGGGAAGTTTTCTACTTTTGGCTTG
TGCTTCTCAAGCACCAAATCTTAAAACAGAGAGACACACGATAAATAAGAGGCAATCTACTCGTCCATTCTCATGATGCAGCGCAGGCCCTCCCCCTTGA
GCATGAGGTCGAACGCCGTGTTGATCTGCGAGAAAGGCACGCTGTGGGTGATGAACTTCTCCAGGTCCAGCTCCTTCCTCATGTACATCTCCACGACTTC
CGGGAGGTCGGTCCGCGGCTTGTAGTTGCCGAAGAAGGTGCCCTTCAGGGTCCTCTCATTGAGCAAGTTCATCGGGCTTGTCTTGAACACCGCCTCCTTG
TGCGGGACGCCCACCAGCACCGCCACGCCCCAACCATCATGGACACATTCGAAGGCGGCGATCATGGCGTCGATGTGGCCAGTACACTCAACCGCACGGT
CGACGCCGCCATTGGTCATCTCGACAAGCACCTGGAGAGCAACATTGCACATTGAGTTTTTGGCACAGGATTGTGCATGTCATGAAGAACGAACAAAGGT
GAAAATATGTGTTGAGGGAGATGGAAAGAACTCTTGCACTGGCTTGGTGTGGTCCTTTGGGTTCACAAAGTCGGTGCATCCAAATTTCTTAGCTTGTTCG
TATTTTGCAGGGTTCAAATCCACACCAATGATCCTTGATGCCCCAGACATCTTGGCCCCTTCCATGGCAGCAAGGCCTACAGCTCCNAGACCGAATATGG
CCACCGTCNAACCCTTTTTTCGGTTTC
page-top