Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2472
Contig Information
Length 848 bp
Tissue Liquid cultured tissue
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvs1f22    whvs7a07    whvs8o08    whvs13i19    whvs10c02    rwhvs1f22    rwhvs7a07    rwhvs8o08    rwhvs13i19    rwhvs10c02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|7248415|dbj|BAA92738.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|24413953|dbj|BAC22205.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|113594653|dbj|BAF18527.1| Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|125553806|gb|EAY99411.1| hypothetical protein OsI_21382 [Oryza sativa Indica Group] >gi|125595832|gb|EAZ35612.1| hypothetical protein OsJ_019095 [Oryza sativa (japonica cultivar-group)] >gi|149391053|gb|ABR25544.1| 60S ribosomal protein l13-2 [Oryza sativa (indica cultivar-group)] >gi|215678596|dbj|BAG92251.1| unnamed protein product [Oryza sativa Japonica Group]
Score 806
Evalue 3.81841e-84
Total Hit Count 319
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2472
CCCCGCAAAACCCTAGCCTTTCCCCGCGCCGCCCCCGCCGCCGCCCCGTCGTCCCCAGGTAAGGAGGAGGGCGAGATGGTGAAGCACAACAACGTCATCC
CCAACGGCCACTTCAAGAAGCACTGGCAGAACTATGTCAAGACGTGGTTCAACCAGCCCGCCCGCAAGCAGAGGCGCCGCATCGCTCGCCAGAAGAAGGC
TGTGAAGATCTTCCCCCGTCCTACCTCTGGACCTCTTCGCCCCATTGTGCAATGCCAGACCCGCAAGTACAACATGAAGGCCAGGGCTGGCAGGGGATTT
ACCCTTGAGGAGCTTAAGTCCGCTGGCATCCCAAAGAAGCTCGCTCCGACCATTGGCATTTCTGTGGACCACCGCCGCAAGAACAGGTCGCTTGAGGGTA
TGCAGTCCAACATCCAGAGGCTCAAGACCTACAAGGCCAAGCTTGTCATCTTCCCAAGGCGTGCTCGCAAGGTCAAGGCTGGTGACTCTACTCCGGAGGA
GCTTGCCAATGCCACACAGGTCCAGGGCGACTACATGCCCATTGCCCGTGGCGAGAAGCGCTCAGTCGAGGTCATGAAGGTCACAGAGGAGATGAAGGAG
TTCAAGGCCTATGGCAAGCTCCGCGTCGAGAGGATGAACCAGCGCCAGTTGGGAGCCAGGCAGAAGAAGGCTGCCGAGGCGGAGAAGGAGGAGAAGAAGT
GATGAGATATGCTTAAGGCAGCTAGTGGGTTCTGTTGTTATCAAGTGCTAGTTTCTAAATTTGTGTTTTGGCCTTCTCGGACATCTTGTTTGATACCTGA
TATACTTATTTGCATGATCTGCTATCAAATCTTATCCTAAAAAAAAAA
page-top