Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2466
Contig Information
Length 1403 bp
Tissue Liquid cultured tissue
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvs1c20    whvs2c24    whvs3d10    whvs9g17    whvs14b07    whvs18c02    whvs18c13    rwhvs14b07    rwhvs18c02    rwhvs18c13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH2A [Triticum aestivum]
Score 1919
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2466
GCAAGCAGAGACAGCGACAGAGATCCATCTTCTTTCTCTTCGAGTTCTTGGAGCTAGCGACCGACAGGGACAGGGATGGCGACCGCCGGGAAGGTGATCA
AGTGCAAAGCGGCGGTGGCATGGGAGGCCGGGAAGCCGCTGTCGATCGAGGAGGTGGAGGTGGCGCCGCCGCAGGCCATGGAGGTGCGCGTCAAGATCCT
CTACACCGCCCTCTGCCACACCGACGTCTACTTCTGGGAAGCCAAGGGGCAAACTCCGGTTTTCCCTAGGATCTTGGGCCATGAAGCTGGAGGCATTGTT
GAAAGTGTCGGAGAGGGTGTGACCGAGCTCGTGCCGGGCGACCATGTACTCCCGGTCTTCACCGGCGAGTGCAAAGACTGTGCCCACTGCAAGTCAGAGG
AGAGCAACCTTTGTGACCTCCTCAGGATCAACGTGGATCGTGGCGTGATGATCGGGGATGGGCAGTCAGGCTTCACCATCAACGGGAAACCCATCTTCCA
CTTTGTCGGGACCTCCACCTTCAGTGAGTACACTGTGATCCATGTTGGTTGCCTCGCCAAGATCAACCCCGAGGCGCCCCTTGACAAAGTTTGTGTTCTC
AGCTGTGGCATCTCAACTGGACTTGGTGCTACCCTCAATGTCGCGAAACCGAAAAAGGGTTCCACGGTGGCCATATTCGGTCTTGGAGCTGTAGGCCTTG
CTGCCATGGAAGGGGCCAAGATGGCTGGGGCAGCAAGGATCATTGGTGTGGATTTGAACCCTGCAAAATACGAACAAGCTAAGAAATTTGGATGCACTGA
CTTTGTGAACCCAAAGGACCACACCAAGCCAGTGCAAGAGGTGCTTGTCGAGATGACCAATGGCGGAGTCGACCGTGCGGTTGAGTGTACTGGCCACATC
GACGCCATGATCGCCGCCTTCGAATGTGTCCATGATGGGTGGGGCGTGGCGGTGCTGGTGGGCGTCCCACACAAGGAGGCGGTGTTCAAGACAAGCCCGA
TGAACTTGCTCAACGAGAGGACCCTGAAGGGCACCTTCTTCGGCAACTACAAGCCGCGGACCGACCTCCCGGAAGTCGTGGAGATGTACATGAGGAAGGA
GCTGGACGTGGAGAAGTTCATCACCCACAGCGTGCCCTTCTCGCAGATCAACACGGCGTTCGACCTCATGCTCAAGGGGGAGGGCCTGCGCTGCGTCATG
AGGATGGACGAGTAGATCGCTTCTTATCCATCGTTTTAACATTTGGTGCTTGAGAAGCACAGGCAATTTTTTTTAGAAAACCTCCGTCGGGTAATAATCG
TGTGTGCTAGTCGTGAGATGTGCATGTGTTCATCTCTATGCTCTTTGTTTAGTGTTCACGGTTTGGTCTTTGGTTTCATTGTGTCTATCGGCAGCTTTCA
GTG
page-top