Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2451
Contig Information
Length 1047 bp
Tissue Liquid cultured tissue
Clones 9 Clones [Download: CSV  ,  FASTA ]
whvs1c23    whvs5a05    whvs11i05    whvs12e11    rwhvs1c23    rwhvs5a05    rwhvs11i05    rwhvs12e11    rwhvs13g01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32842 [Oryza sativa Indica Group]
Score 1332
Evalue 5.44045e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2451
TTTTTTTTTTGAAGATGATGCGCCAAAAANTAGTATTACACACCCAAAAGGTTCGGGGCCGAATCAGGTACATATCCACAAGGACCAAAATTGGAGCAAG
TTTGGGGGTACATATCCGTTCCGTTCACATAAACATGCGCGGCATTATTGCTCAATCCTAAGAGCTTCAACCAGAGTTCATTCCGGAGGTTAAACACACC
CATTTTCACAAAAACTCGCGAAGATACCGTCTAGTAGGGCTCCACCGGTGCGCGGAACTTGAGGCCAGCATACACTGCAGCGTCGCCCAGCTCCTCCTCG
ATCCTCAGAAGCTGGTTGTACTTGGCAAGACGCTCTGACCGGCAGGGAGCCCCGGTCTTGATCTGACCCGTGGACAGACCAACAGCCAAATCAGCAATGA
ATGTGTCCTCGGTCTCACCACTCCTGTGGCTGGTCATGACACCCCAGCCAGCATGTTTTGACATCTTCACGGCCTCGATACTCTCAGTGACGGATCCAAT
TTGGTTAACCTTCAGCAGAAGAGCATTGCATGACTTCTCCTGGATTGCCTTCGCAACTCTGGTTGGGTTGGTGACTAGAAGGTCATCACCAACAATCTGA
ACTTCCACTCCACATTCTTCAGTCATCTTAGCATAGTGCACCCAGTCATCCTGGTCAAATGGGTCCTCAATCGACACAATGGGGTACTCACTCACAAATG
ACTTGTATACGTTCTTCAGGCTATCTCCAGATATCTTCTGAGAACCATCATTGTTCTCCTCCTTGAAGTTGAGGTCATAGGTTTTGTCCTTGTCATTGTA
GAACTCTGAAGCAGCAACATCCATTCCAATGACAACCTTGCCGGTGTATCCAGCCTTTTCAATTGCAGTCTTCAAGAGCTCAAGGCCCTCCTTATTCTCC
TGAATGTTAGGAGCAAAACCACCTTCATCTCCGACATTGGTGGCATCCTGCCCGTACTTCTTCTTGATAACAGACTTCAAGTTGTGGTACACTTCAACAC
CCNTCTTCATTGCCTCCTTGAATGAGGCAGCTCCAGTAGGAAGGATC
page-top