Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2415
Contig Information
Length 845 bp
Tissue Liquid cultured tissue
Clones 8 Clones [Download: CSV  ,  FASTA ]
whvs4k10    whvs8g11    whvs8n10    rwhvs4k10    rwhvs8g11    rwhvs8n10    rwhvs8n21    rwhvs12k05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 5.87864e-69
Total Hit Count 419
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2415
CAAACTCTGCATCCAACAGAACAAACACGATATGATATTTAAGGTATCTGACACGCTGACACAAACAAGATATTGGACAGGAAACAGTTCTGAACTTCTG
ATGTTCCAAAATTAGGCTAACCCTTCATAGTACCAGAAAGCTAAAGCTTCATGTCAGAACTTCACTTCTTGGCCTTCTTTGGTGCCGCAGCTGGAGCTGC
AGCCGCTGGTGCTGGTGCATGATCTCTCGGGCCCTGGGCCAATCTCTCCTCCCTCCTGGCAATCTTCCTCTCCCTGCTTGCCTTGCTCTTGGCGCGCTTG
GCCTCAAACTGGTCAGAGAGGGTCTTCTCTCTTGCCTTCTCAGCCTTGGACTTGTGGATACTCTCCATGAGGACCCTCTTGTTCTTGAACATGTTACCTT
TGACCTTCAGGTACATGTCATGGTACATGTGCTTGTCGATCTTCTTGGCCTCACGGTACTTGCGCAGAAGGCGCCTCAGGACGCGCATCCTCCGCATCCA
CAGGATCTTGGTGGGGAGCCTAGCCTCCCTGGTACCCCTACGCTTACCATATCCAGAGTGACGGCCCTTCTGCTTGGCCTCATGTGCCCTCCTTGCACGA
GACCTGGAGTGGATCTTCTGAGGCTTCCTGATGATGAAACCATCCTTTACCAGCTTCCGGATGTTCTGCCGGGAGTTGGCCATGGAGATCTCGTTGACCT
CATTGGGGTCGAGCCAGACCTTGCCCTTGCCGCACTTGAGGACGCTCGAGGCCAGGCGCTTCTGCAGCTTCAGCGACACCATCTTCGCCGCCGCTCTCCT
CCTCCTCCCGTCTGGGTTGTGGCCTCGTGCCGAAATTCCTGCAGC
page-top