Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2413
Contig Information
Length 1004 bp
Tissue Liquid cultured tissue
Clones 8 Clones [Download: CSV  ,  FASTA ]
whvs1d18    whvs1l07    whvs11o03    whvs14d22    rwhvs1d18    rwhvs1l07    rwhvs11o03    rwhvs14d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione S-transferase 2 [Oryza sativa (japonica cultivar-group)] >gi|218190996|gb|EEC73423.1| hypothetical protein OsI_07693 [Oryza sativa Indica Group]
Score 979
Evalue 4.39463e-104
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2413
TTTTTTTTTTGAAATGTAAGCCACTGATGTTTCATCTTGTTGCTATTTCACGTAAGTCCAGAATTCCAGATATCCAAAGGCTAGTGATCACAATTATTTC
ACTGTTTTGATACAGACTACAGTAGTTACTTTACACTTGGTGCAGGAAGTTCTGTGCTTATTGTTACAGAGTTTGAAGTAACGGGACAGGACACACACAG
GTACAGACAAAGCAGTGAGAACTACTGATTCACTCCCGGCCTATGTCTAGGCAGAGGAAGGGGCATCCGGCTGCCGGTCAGGGAGCGCAGCTTCAAATGC
AGGGTGTGTCATATATTGATCGTAGAGCCTCGCGAGGGTGGGATAGTTCGACATGTCGATTTGATAACGAGTCACCGCAGCAAAAATCTGGGGTGCAAGG
AATACATCTGCCAGTTGGACTTCATCTCCCATAGCAAACTTCCCAGCACAGCCTTTGATCATGTTCTCAACAGCTGTGAAACCTCTATCAATCTGTTGTT
TGACCCACGGGATGCTCTCCCCTGTTCCAACTTTTTGCTCGATAAATCTCACCAAGGTGAGATTGTGAAGAGGTTGAATACCAGAACACACAATGCTTGC
TATCTGGATATTCAGGGCCTTCTTTTTAAGGTCTTGGGGCAAAAGAGGGCGCTGAGGGTACTTGTCCTCCAAATACAATGCTATTGCGTAAGAGTCGCCG
ATTACTGCGTCGCCGTCGACCAAGGCAGGGACGAACTTCATAGGATTAAGCTTCATGAACTCAGGATCAGACTGCTCGCCCTTGAGGAGGTTCACCGCCT
TGTACTCATAATCGATACCTTTGAGGTTGAGCGCGATGCGGACGCGGTGGGAGCAGGAGCTGCGCCAGTACGAGTAGAGAATCGGCCTTGCCGTCGGAGC
CTCCGCCGAAGCCATTCGGAGCTAGCAGCAGCTCGGTCTCGGAGGCGCGGATTCGTGGCCGGCGGCCAGGGAAGAAGTGGACCACGGCAGCGCTCGGTCG
AGCC
page-top