Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2406
Contig Information
Length 1462 bp
Tissue Liquid cultured tissue
Clones 8 Clones [Download: CSV  ,  FASTA ]
whvs1e11    whvs6m04    whvs12f11    whvs12f12    rwhvs1e11    rwhvs6m04    rwhvs12f11    rwhvs12f12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine synthetase [Triticum aestivum]
Score 1991
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2406
GTTTCAATCTTGGTCGCCACCATTACCATGACATGAGCAGATAAGAACACAAGTAGCACACCCACAATACAAGCACCTCTAAACACAGACACTCAAAAAA
AAAAACTTGCACCATTGCAGCAAGCACTGGAGCAGNGAATAAANATATTACTTGCTGGGATAGGTAAAACTAAATTTATTCAAANAGTTCGCTAAGNGTT
TGCTCACGCAAAAGGCTTCTCCCACTTGAGGGGCTTCACCACCTCCCAGGGGAAGTCTGCGCCCTCCCTGCCGAAGTGACCGTATGCCGCCGTCTTGAGG
TAGCGCCCCTTCCCACCCCTCTTGAGGTCGAGGTTGATGATGATCATGCCTGGCCTGAAGTCAAAGTTCTCCTTGACAATCTCGAGGATCTCCTTGTCAG
GGATCTTGCCCGTGCCGTATGTGTCGACAAACACCGAGAGTGGTTCAGGCACGCCAATAGCATAAGACACCTGGACGATGCAGCGGCGGGCAATGCCGCT
TGCAACAATGCTCTTCGCCGCCTGCCTGGCAACATATGCACCACTGCGGTCAACCTTGGTCGGGTCCTTGCCAGAGAAAGCGCCTCCACCATGAGCTCCC
CAGCCACCATAGGTGTCAATGATGATCTTCCTGCCAGTGAGACCAGCATCACCGTGAGGTCCACCAATGACAAAGCGGCCAGATGGGTTGAGATGGAAGA
TGGTATTCTCATCAAGGTACTGCTCTGGGATGACAGGCTTAATCACATGCTCCTTCAGATCAGCAGCAATCTCATCATTGGTCACTGTCTCATCGTGCTG
GGTGGAAATGAGCACAGTGTGGACACGTATAGGGACCATAGCACCATTGTCATTGTGATACTCCACAGTCACCTGGGTCTTGCCATCAGGCCTCAACCAC
GGGCAGGTGGCGTTCTTGCGGACCTCGGTGAGACGAGCACCAAGCTTGGTAGCAAGAACATGGCTGAGGGGCATGAACTCCGGAGTCTCATCAGTTGCAT
ATCCAAACATATGGCCCTGGTCACCAGCGCCAATCTCCTCAGGCCGCTTGGTAAAGTGGCCATGGACACCCTGCGCGATGTCAGGGGACTGCTGCTCAAT
GTTGACAAGTACCTTGCAGTGGTCAGCATCAAGCCCTACATCATTGGACACAAAACCGATGCCACGGCAAGTATCCCTGACAATCTTCTCATAGTCAACA
TTGGCCTTGGTAGTGATCTCACCGAAAACCATGACCATGTTGGTCTTGGTGCATGTCTCACAAGCAACCTTGCTGTCAGGGTCTTCAGCCAGGCATGCAT
CTAGCACAGCATCAGATATCTGGTCGCAGAGCTTGTCAGGGTGCCCCTCATTGACAGACTCAGACGTGAAGAGGAAGGTTTCAACTTCAGCCATCTTCTT
TGGCCTTGTTCGCTTGTGGCGGCGGGGGCGGCGACGGCGGCGGGAGGCTAGGGGATGACGTG
page-top