Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2384
Contig Information
Length 1000 bp
Tissue Liquid cultured tissue
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvs1e19    whvs10e06    whvs10n21    rwhvs1e19    rwhvs3j12    rwhvs10e06    rwhvs10n21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1027
Evalue 7.55074e-112
Total Hit Count 487
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2384
ACACGAACAAAATAAGATAGCTGAACGCTGGCTAGGAATGTCGACACAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAG
GTGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCGACTTCTATTCTCTACTCAGCAGCAGCAACCTCCTCCGCACCAGGAATGACCTCGTC
CCCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGTAGTCACCGTGAACCTCCATGAGCTTCCCCAGGTCGAACTTGGGGGCCTTCAGGATC
TTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCTTGAGGTGGCCTTCTCAATCTCCTTTCCGATCACCTCAGGGATGAACTTGTTCACAAGCT
CCTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCAC
CTGGTTCGGGCGTCTCTTGGTGAAGCCAATGGCGAACATGCGAAGCATGTAGTTGTCAGTTGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCAC
TTCCTCACAAGGGACCTGAGCTTGTCAGTGGTGAAGTCCATGCCCCAGAAGTTGGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCT
TCCTGTAGGCCTGGTCCTCGTCGTTCTGAAGATCAACTAGAGATACTTCAAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGTGTCCT
GGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGGCGCCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTCTT
GCTACCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTGAGCGT
page-top