Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2376
Contig Information
Length 853 bp
Tissue Liquid cultured tissue
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvs1d19    whvs2e08    whvs3h03    whvs7a23    whvs8c02    whvs11j24    whvs18a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1-alpha-like protein [Solanum tuberosum]
Score 1159
Evalue 1.00708e-131
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2376
CGCCGCCGCAGGCTTTGACTCCATCGCCTCCTCCCTCCTCCTCTTCGTCTCCGGCAGGCCAGGTAGTTAACAGCTCCAGCAGCCATGGGAAAGGAGAAGA
TCCACATCAGCATTGTGGTCATTGGCCATGTTGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGCTTGGAGGCATTGACAAGCGTGTGAT
CGAGAGGTTCGAGAAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGAGGGGTATCACC
ATTGATATTGCTCTCTGGAAGTTCGAGACCACCAAGTACTCCTGCACTGTCATTGATGCTCCTGGTCACCGTGATTTCATCAAGAACATGATCACTGGGA
CCTCCCAGGCTGATTGTGCTGTGCTTATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCT
TGCGTTCACTCTTGGTGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCTAAGTACTCGAAGGCCCGTTATGAAGAAATTGTCAAG
GAAGTCTCTTCATACCTGAAGAAGGTCGGTTACAACCCTGACAAGGTTCCCTTCGTTCCCATCTCTGGGTTCGAGGGTGACAACATGATTGAGAGGTCCA
CCAACCTTGACTGGTACAAGGGCCCCACCCTTCTTGAGGCCCTGGACCANATCAATGAGCCCAAGAGGCCCTCCGACAAGCCCCCTGCGTCTTCCCCTTC
ANGACGTCTACAANATTGGTGGCATTGGAACTGTGCCANTGGGGGCGTGTTGA
page-top