Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2373
Contig Information
Length 1798 bp
Tissue Liquid cultured tissue
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvs3d16    whvs16i13    whvs19k09    rwhvs3d16    rwhvs4p15    rwhvs16i13    rwhvs19k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH2B [Triticum aestivum]
Score 1982
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2373
AAATTACTTCTAGTTAGAAACCACATGACCAAGCGTGAATGACAATAGTTAATCCCCAGGACCGGGAGGCGATCGAACAGCAGAGCCCCAGGTGAAACTT
AAGTACATAAGATATGCCATTCCGTACTCCACAACCACTATCCAGTCAAGTTCATGGGCTAGACCCTTTCTTGAACAGCTTGATTTGGTCACCATAGTAG
TACGCGCTGCCGACCATCAGAGCAACCGTAACGCCTTGAGCAACCACACGGGCCCTCATCAGCTTCTGACCCAGCCGAGAATTCCCGTACCGGAAGCTGA
CCAGGCCAGCTGTCAGGACACCCGCAGTGACCAATGCACCGATGGGGACGAAGGGGTTCTTGACGGGCTTCTTCCCCTCGAACGGGAACTCGTCCAGCTG
CGGCATCGGCGGTGGCCGCGCGCTGCTTCCTGCGGCGGCGCCGGAGCCCTTCTCCATTCGCGTCGCCTGGGAGGAAAAGGGGGGAGGGGGGACGCTTTTC
CGAACTCGAGGGAAGTCCTTATAACTTTCTTCTTCTTTTGTTTAAAGCAGCGAGGGTGCGATGAAGAAGCTGGATCTACTCGTCCATCCTCATGACGCAG
CGAAGTCCCTCTCCCTTGAGCATGAGGTCGAAGGCCGTGTTGATCTGCGAGAAGGGCACGCTGTGGGTGATGAACTTCTCCACGTCCAGCTCCTTCCTCA
TGTACATCTCAACGACTTCCGGGAGGTCGGTACGCGGCTTGTAGTTGCCGAAGAAGGTGCCCTTCAAGGTCCTCTCATTGAGGAAGTTCATCGGGTGGGT
CTTGAACACCGCCTCCTTATGGGGGACACCCACCAGCACCGCCACGCCCCACCCATCGTGAACGCATTCGAAGGCGGATATCATGGCGTCGACGTGACCC
GTGCATTCCACGGCTCTGTCGACTCCACCGTTTGTCATCTCGACAAGCACCTCTTGCAATGGCTTGGTGTGGTCCATTGGGTTTACAAAGTCGGTGCAGC
CAAACTTCTTGGCTTGTTCGTATTTTGCAGGGTTCAAGTCCACACCGATGATCCTTGATGCCCCAGCCATCTTGGCCCCTTCCATGGCAGCAAGGCCTAC
AGCTCCAAGACCGAAAATTGCCACCGTCGAACCCTTTTTCGGTTTTGCGACATTGAGCGTCGCACCAAGACCAGTTGAGATACCACAGCTGAGAACACAA
ACTTTGTCGAGGGGTGCCGAGGGGTTGATCTTCGCTAGGCACCCAACATGGATCACTGTGTACTCACTGAAGGTAGAGGTCCCGACGAAGTGGAATATCG
GTTTCCCGCTGATGGTGAAGCGGGACTGCCCATCACCGATCATCACGCCTCGGTCGACATTGATCCTGAGGAGGTCACAAAGGTTGCTCTCCTCTGACTT
GCAGTGAGCACAATCCTTGCACTCGCCAGTGAACACCGGCAGGACATGGTCACCTGGCACAAGCTCGGTCACGCCCTCTCCGACGCTCTCAACAATGCCT
CCAGCCTCATGGCCCAAGATCCTTGGAAAAACCGGAGTTTGCCCCTTGGCTTCCCAGAAGTAGACGTCAGTGTGGCAGAGGGCGGTGTAGAGGATCTTGA
CTCGCACCTCCATGGCCTGCGGCGGCGCCACCTCCACCTCCTCGATCGACAGCGGCTTCCCGGCCTCCCATGCCACCGCCGCTTTGCACTTGATCACCTT
CCCGGCGGTCGCCATTAACCCACTCGATCGCTCCGGGAACTCAAAGAGAAAGATCGATCTTGATCTCTCGTTCCTGCTTCTGCTTTGCAGTTGGTTGG
page-top