Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2329
Contig Information
Length 605 bp
Tissue Liquid cultured tissue
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvs6h02    whvs8i11    whvs20n11    rwhvs6h02    rwhvs8i11    rwhvs20n11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.3793e-26
Total Hit Count 342
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2329
GCCTCCTGCGCCTCCACTTCCATCGCCTCCCAAGATCTGCTCCGGTGAGAATCCGTCGCCATGTCTTCCAGCGAGGTCGCCTGCACCCTTGCCGCCCTCA
TCCTCCACGATGACGGGATCCCCATCACTTCTGAGAAGATCGCGACGGTGGTGAAGGCTGCCGGAATCAAGGTTGAGGCCTACTGGCCCGCGCTCTTCGC
CAAGCTCCTGGAGAAGAGGAGCGTCGATGACCTCATCCTTTCCGTCGGATCTGGTGGAGGTGGTGCTCCAGCTGCTGCTGCTGCTGCCCCGGCTGCTGGT
GGTGCTGCTGCCGCTGAAGAGAAGAAAGAAGAGAAAAAGGAGGAGGCTAAGGAAGAGAGCGATGATGACATGGGCTTCAGCTTGTTCGACTAAGCAGTTC
AATTCCAGTTCTCCTGTGGAATCTTTTATGCTAAGGATTACTTATCTTATGTGCTTTTAGGTCGAATTTTGCGGATTTAATATGTTTGAGACCTAAGTAT
CTGTGCAATGAGTACTGCAAACCACCTTGGGATGGTCTTTTTAGAATGAAAATGGTTTTGGTGCTTGGTTGAAAAGCCATTGCTTGTTTTACCCTAAAAA
AAAAA
page-top