Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2326
Contig Information
Length 687 bp
Tissue Liquid cultured tissue
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvs3j04    rwhvs1e08    rwhvs3j04    rwhvs8a09    rwhvs12d01    rwhvs20a14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L27a-3 [Zea mays] >gi|195621814|gb|ACG32737.1| 60S ribosomal protein L27a-3 [Zea mays]
Score 619
Evalue 1.23009e-62
Total Hit Count 430
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2326
GGATAACTCGTCTGATATAAACTGGGCATAACATAGCGCAAAATTCTCATAAGATGTTGGTTTACCACACAGGAACCAGGATAACAAACTAACGATGTCT
TGTTCAACACAAATTGCTGGTACGGGAAACAACTAATAGTTCAGATATAATAGATCTCAAGGCACGGTCGCGAACAGAACCCTAGGCAACGAGCACGACA
GCGCCGCCGGCGGCCTTGATCTTCTTCTCTGCGATCTTGGAGATGAGCTTGGCCTTGACGACGATGGGCTTCTCCGGCAGCATCCCCTTGCCGAGCACCT
TGAAGTAGCCGAACTGCGAGACGTCGACCACGGGGGCCTTGTCGCCGCCGGCCTCGGCCGCCTTCTCGGACGGCACCATGGACCAGAGCCTCTCGACGTT
GACCGTCGGGGTGTAGAACCTGTTGCTGAGCTTGTGGAAGTAGCGCATACCGACCTTGCCGAAGTAGCCGGGATGGTACTTGTCGAAGAGGATGCGGTGG
TGGTGCATGCCTCCGGCGTTACCGCGGCCTCCGGGATGCTTGCGGTGCTTGCCCACACGCCCGTGCCCGGCGGACACGTGGCCGCGCTTCTTCCGGTTCT
TCTTGAAGCGGGTCGTCATCGCCGCCGCTCGCTCGCCGCCGCCGCGGGCTTACCTTGGAGGAGAGGGGTCGGGGAGGATGGGGTGGA
page-top